The present invention is directed to a yeast strain, or strains, secreting a full suite, or any subset of that full suite, of enzymes to hydrolyze corn starch, corn fiber, lignocellulose, (including enzymes that hydrolyze linkages in cellulose, hemicellulose, and between lignin and carbohydrates) and to utilize pentose sugars (xylose and arabinose). The invention is also directed to the set of proteins that are well expressed in yeast for each category of enzymatic activity. The resulting strain, or strains can be used to hydrolyze starch and cellulose simultaneously. The resulting strain, or strains can be also metabolically engineered to produce less glycerol and uptake acetate. The resulting strain, or strains can also be used to produce ethanol from granular starch without liquefaction. The resulting strain, or strains, can be further used to reduce the amount of external enzyme needed to hydrolyze a biomass feedstock during an Simultaneous Saccharification and Fermentation (SSF) process, or to increase the yield of ethanol during SSF at current saccharolytic enzyme loadings. In addition, multiple enzymes of the present invention can be co-expressed in cells of the invention to provide synergistic digestive action on biomass feedstock. In some aspects, host cells expressing different heterologous saccharolytic enzymes can also be co-cultured together and used to produce ethanol from biomass feedstock.
A system and computer-implemented method for machine learning modelling of user interface interaction are provided. The method includes training a collection of machine learning algorithms using training data to discriminate between users with and without a neurological condition by identifying patterns in a feature set which are indicative of the presence or absence of the condition and labelling the feature set accordingly. The collection of machine learning algorithms includes a locally deep support vector machine-based algorithm and a consensus algorithm. The training includes: receiving, from a mobile communication device, a payload including recorded data points; compiling at least a subset of the recorded data points into a feature set; and learning from the compiled feature set by reference to a provided pre-labelled feature set labelled with a condition of a user who caused generation of data points from which the pre-labelled feature set is compiled.
A61B 5/16 - Devices for psychotechnicsTesting reaction times
A61B 5/00 - Measuring for diagnostic purposes Identification of persons
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
G16H 50/50 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for simulation or modelling of medical disorders
11 __block __2n111 __alt __2m 22 __alt __1m2NN NNNN1 altblockblock-PVP block copolymer. The block copolymers can be formed by RAFT polymerization in a one pot, one step process. These block copolymers and pharmaceutical compositions including them can be used to treat or prevent diseases, for example cancer.
A61K 47/50 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
C08F 293/00 - Macromolecular compounds obtained by polymerisation on to a macromolecule having groups capable of inducing the formation of new polymer chains bound exclusively at one or both ends of the starting macromolecule
Disclosed herein is a dissection station for a cadaver. The station includes a tray having an arrangement of ventilation openings which allow a passage of fluid from the tray and an elongate form configured to support the cadaver. The station further includes an elongate bath disposed below the tray and configured to support the tray; a drainage system including a drainage outflow from the bath; and a gas extraction system including an exhaust duct from the bath. Further disclosed herein is an installation of a dissection station which is configured to force gas from a ceiling gas insertion mechanism toward the tray and through the ventilation arrangement to the bath and from the bath through an exhaust duct extension.
Embodiments of the present disclosure pertain to methods of treating or preventing a disease or condition in a subject by administering a therapeutically effective amount of a compound to the subject. The compound generally includes a compound of Formula I, Formula II, Formula III, or Formula IV. Additional embodiments of the present disclosure pertain to compounds that include a structure of Formula I, Formula II, Formula III, or Formula IV. In some embodiments, the compounds of the present disclosure are suitable for use in treating or preventing a disease or condition in a subject.
Block copolymers which comprise an amphiphilic copolymer block and a hydrophilic polymer block are provided. The block copolymer can be used as a universal means to solubilize membrane proteins, and optionally also to tether membrane proteins to a surface. The amphiphilic block solubilizes membrane proteins into SMA lipid particles (SMALPs), to which the hydrophilic polymer block provides steric stabilization so that the SMAPLS are stable over a wide pH range and in high ionic strength solutions. The hydrophilic polymer block optionally includes a functional end group that allows the block copolymer to attach to a surface. Amphiphilic copolymers for the amphiphilic block include SMA, DIBMA and derivatives thereof. Examples of hydrophilic non-ionic polymers that can be used to form the hydrophilic block include poly(acryloyl morpholine) (PAMO), poly(N-vinylpyrrolidone) (PVP), poly(ethylene glycol) (PEG), poly(2-hydroxyethyl)methacrylate, poly(vinyl alcohol) (PVA), poly(glycerol methacrylate).
C08F 293/00 - Macromolecular compounds obtained by polymerisation on to a macromolecule having groups capable of inducing the formation of new polymer chains bound exclusively at one or both ends of the starting macromolecule
Methods, devices, kits and computer-implemented methods for diagnosing (and optionally treating) tuberculous meningitis (TBM) are provided. In one embodiment, the method comprises testing a cerebrospinal fluid (CSF) sample from a subject suspected of having TBM for the presence of MPO and at least two other biomarkers, at least one of the other biomarkers being selected from the group consisting of IFN-γ, sICAM-1, VEGF-A and CXCL8. For example, the method can comprise testing the sample for MPO, IFN-γ and VEGF-A or for MPO, IFN-γ, sICAM-1 and CXCL8. In another embodiment, the method comprises testing a blood sample from a subject suspected of having TBM for the presence of at least one biomarker selected from the group consisting of adipsin (complement factor D), Ab42 and IL-10, and at least two other biomarkers. In one example, the method comprises testing the sample for the presence of adipsin (complement factor D), Ab42 and IL-10.
A61B 10/00 - Instruments for taking body samples for diagnostic purposesOther methods or instruments for diagnosis, e.g. for vaccination diagnosis, sex determination or ovulation-period determinationThroat striking implements
An anthropometric growth apparatus (101, 201, 501) for measuring the anthropometry of an infant is provided. The apparatus comprises a base (103, 203, 503) with a digital scale assembly (105, 205, 505) mounted to the base and configured to measure a weight of the infant. A digital length measurement assembly (107, 207, 507) is mounted to the base and configured to measure a length of the infant. A head circumference measurement assembly (109, 209, 509) is mounted to the base and includes an array of distance sensors (111, 211, 511) provided on a support (113, 213, 513) configured to position the array of distance sensors at a selected distance from the head of the infant for non-invasive measurement of the head circumference in use. The apparatus may further be used for body composition and gestational age determination.
Terpolymers comprising optionally at least partially substituted styrene repeat units, N-alkylmaleimide repeat units and repeat units selected from the group consisting of maleic anhydride repeat units, maleic acid repeat units or maleic anhydride derivative repeat units and having a narrow molecular weight distribution are provided. The terpolymers may be used to solubilize lipid bilayers to form lipid nanodiscs and isolate membrane proteins.
A method for diagnosing TB or for ruling out TB is described. Devices and kits for use in performing the method are also disclosed. The method comprises testing a biological sample from a subject for CRP and at least one other cytokine biomarker selected from the group consisting of SAA, CXCL10/IP-10, SAP, CCL1/I-309, CXCL9/MIG and ferritin. Typically, the biological sample is contacted with capture agents which can bind to the biomarker(s) of interest, and binding of the capture agents to the biomarker(s) is detected. The sample is typically a blood sample, and more particularly a fingerstick (capillary) sample. A lateral flow assay can be used to perform the method, e.g. using up-converting phosphorous technology.
A method of diagnosing tuberculosis (TB) is provided. The method comprising the step of testing a biological sample from the subject for the presence of CC4 and at least one other biomarker selected from the group consisting of CC4b, procalcitonin, CCL1, apolipoprotein-CIII, RANTES and TNF-α. A device, kit and computer-implemented method for diagnosing (and optionally also treating) TB are also provided.
SOUTH AFRICAN MEDICAL RESEARCH COUNCIL (South Africa)
Inventor
Dijkstra, Stephan
Theron, Grant De Vos
Nieuwoudt, Martinus Johannes
Venter, Rouxjeane
Warren, Robin Mark
Abstract
An extraction device assembly for extracting a sample from a sample-containing chamber of a nucleic acid amplification cartridge is provided. The assembly has a cartridge interface forming a receptacle configured to at least partially fit the sample-containing chamber therein. The cartridge interface has an aperture configured to at least partially expose the sample-containing chamber, and a collection interface having an aperture configured to at least partially align with the cartridge interface aperture and with the sample-containing chamber positioned at least partially between them. The collection interface aperture is in fluid communication with a collector. The extraction device assembly is operable to fit the sample-containing chamber in the receptacle of the cartridge interface and guide a piercing tool into the cartridge interface aperture to pierce the sample-containing chamber and liberate a sample contained therein for transferral to the collector.
A system and method for operations management in a workplace environment incorporating human resources in an automated environment. The system includes a network of a plurality of modular shell components with each shell component configured to include data stores and plugin software components to autonomously manage data and decisions related to the operations of a resource or an activity in an automated environment. In the network, at least one of the shell components is configured for a human resource; at least one of the shell components is configured for a non-human resource; and at least one of the shell components is configured for an activity to be carried out by a human resource or a non-human resource. Each shell component includes a communication component to communicate with one or more other shell components to provide a scalable architecture.
Tulbaghia violaceaAnnona muricataDicoma capensisDodonaea viscosaDodonaea viscosa. A composition including the conjugate, a method for preparing the conjugate, uses of the conjugate and composition for treating cancer, and a kit are also provided. The nanocarrier can be a carbon nanotube, such as a single walled carbon nanotube (SWCNT), and may be functionalised with polyethylene glycol.
A61K 47/69 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
The invention provides a composition comprising an extract of a plant from the genus Sceletium, wherein the extract includes the alkaloids sceletium A4 (sceletium A4 1), an isomer of sceletium A4 (sceletium A4 2) and epimesembranol, and wherein the content of sceletium A4 1 is not less than about 0.9% (w/w) of the total alkaloid content of the extract, the content of sceletium A4 2 is not less than about 1% (w/w) of the total alkaloid content of the extract, and the content of epimesembranol is not less than about 1% (w/w) of the total alkaloid content of the extract. The composition can be used in medicine, such as for preventing, treating or reducing depression, anxiety, stress, stress-induced fatigue or mood, or diseases, disorders or conditions caused by these.
An apparatus and system for measuring and monitoring fouling parameters in a fluid are provided. The apparatus includes a conduit within a housing, wherein at least a portion of the conduit provides a carbon dioxide permeable membrane through which carbon dioxide in the fluid can permeate in use. A carbon dioxide sensor within the housing is configured to measure carbon dioxide levels at the sensor. The housing further includes a light source that irradiates a portion of the conduit and a light sensor that is configured to measure light transmitted through or reflected by the irradiated portion of the conduit to measure the amount of fouling material within the fluid and attached to the irradiated portion of the conduit in use.
An apparatus (100, 200, 300, 400, 500) and system (600) for measuring a concentration of a gas within soil are provided. The apparatus includes a tubular housing (101, 201, 301, 401, 501) configured to extend beneath the soil and a gas sensor (108, 208, 308, 408, 508). The tubular housing includes an outer protective sleeve (114, 214, 314, 414, 514) with perforations (116, 216, 316, 416, 516) therein, a support structure (118, 218, 318, 518) within the outer protective sleeve defining an inner chamber and a gas permeable membrane (102, 202, 302, 402, 502) carried by the support structure and configured to prevent ingress of soil or liquid into the inner chamber. The gas sensor is in communication with the inner chamber to measure a concentration of the gas in the inner chamber.
A method of removing metal ions from solution is provided. The method comprises optionally adjusting the pH of the solution to equal to or above 5, adding a lipopeptide biosurfactant to the solution having a pH equal to or above 5 to form a metal lipopeptide biosurfactant complex, and removing the metal lipopeptide biosurfactant complex. The lipopeptide biosurfactant is selected from the group consisting of surfactin, iturin, fengycin and any combination thereof. The method is capable of removing at least 70% (mol/mol) of the metal ions from the solution.
An electrochemical device for detecting a target analyte in a fluid sample and a method of using the device. The electrochemical device comprises a porous working electrode with a selected receptor immobilised thereon which is configured to detect the target analyte. A porous separation membrane is located between the working electrode and a porous counter electrode. The separation membrane is configured to separate the working electrode and the counter electrode whilst allowing for the passage of fluid sample therethrough. The working electrode, separation membrane and counter electrode are superimposed.
A method of extracting cannabinoids from plant waxes is provided. The method comprises the steps of dissolving the plant waxes in a selected solvent having a normal boiling point above 50 °C and a relative polarity in a range from about 0.1 to about 0.4 at an elevated temperature, thereby forming a solution of the plant waxes and the cannabinoids contained therein and allowing the solution to cool to precipitate the plant waxes whilst the cannabinoids remain in solution.
A probiotic composition comprising Bacillus amyloliquefaciens, Enterococcus faecalis, Lactobacillus salivarius, Lactobacillus johnsonii, Lactobacillus gallinarum and Lactobacillus crispatus is provided. The probiotic composition stimulates the immune response of chickens without negatively affecting growth performance. The probiotic composition can be added to poultry feed to improve the health and performance of chickens, and can be used as a replacement for antibiotic supplementation.
The invention provides a coating method for coating a surface of a substrate material with a biosurfactant. The method includes the following steps: modifying the biosurfactant to promote its reactivity with a silane linker; oxidising the surface of the substrate material; functionalising the surface of the substrate material with a silane linker; and reacting the modified biosurfactant with the functionalised surface. The biosurfactant becomes covalently bonded to the surface of the substrate material. The substrate material may be a polymer such as high-density polyethylene or polyvinyl chloride, or a ferrous metal such as stainless steel. The biosurfactant may be produced by one or more bacterial strains selected from the group consisting of Pseudomonas aeruginosa, Bacillus amyloliquefaciens and Serratia marcescens. The invention also provides articles of manufacture which include substrate materials that are at least partially coated with biosurfactants. The substrate materials and biosurfactants may be as described above.
A01N 25/24 - Biocides, pest repellants or attractants, or plant growth regulators, characterised by their forms, or by their non-active ingredients or by their methods of applicationSubstances for reducing the noxious effect of the active ingredients to organisms other than pests containing ingredients to enhance the sticking of the active ingredients
A01P 1/00 - DisinfectantsAntimicrobial compounds or mixtures thereof
A01N 25/30 - Biocides, pest repellants or attractants, or plant growth regulators, characterised by their forms, or by their non-active ingredients or by their methods of applicationSubstances for reducing the noxious effect of the active ingredients to organisms other than pests characterised by the surfactants
23.
4'-SUBSTITUTED ANALOGUES OF FISETIN AND THEIR USE IN THE TREATMENT OF CANCER
This invention relates to compounds that are 4′-substituted analogues of the flavonol Fisetin. In particular, the invention relates to such compounds wherein the 4′ position on the B-ring is substituted with a ring deactivating group which has a para-Hammett constant greater than zero, and the use of these compounds in the treatment of cancer, including epithelial cancers.
C07D 311/30 - Benzo [b] pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 4 with aromatic rings attached in position 2 or 3 with aromatic rings attached in position 2 only not hydrogenated in the hetero ring, e.g. flavones
E. coli cells which express the fusion protein and include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein regulated by an RNA thermometer.
This invention relates to methods of diagnosing COVID-19 disease, preferably post-acute COVID-19 syndrome, in a subject using a fluorescent or microscopy detection method to detect persistent anomalous (amyloid) clotlets in the sample, wherein the presence of persistent anomalous (or amyloid) clotlets in the sample, particularly clotlets that are resistant to fibrinolysis, is indicative of either acute COVID-19 disease or post-acute COVID-19 syndrome in the subject. The invention also relates to diagnostic kits for diagnosing acute COVID-19 disease, in particular post-acute COVID-19 syndrome, in a subject based on the methods disclosed.
The invention relates to flower extracts from L. leonurus var. albiflora white flower, for use in methods of treating or preventing cellular damage of healthy cells caused by a cancer therapy, comprising administering crude or purified extracts from L. leonurus to a subject or administering compositions comprising said extracts to the subject. Also provided are methods for treating or preventing cellular damage of healthy cells caused by a cancer therapy by administering a crude or purified flower extract from L. leonurus var. albiflora white flower to a subject.
The present invention relates to a bioreactor for the catalytic conversion of a substrate to a product using an immobilized enzyme. The immobilized enzyme is a histidine tagged enzyme, which binds to a nickel-nanoparticle coated cellulose matrix which is housed within the bioreactor. The invention also relates to methods of producing products by enzymatic catalysis using the bioreactor of the invention.
C12N 9/96 - Stabilising an enzyme by forming an adduct or a compositionForming enzyme conjugates
C12N 11/14 - Enzymes or microbial cells immobilised on or in an inorganic carrier
C12M 1/40 - Apparatus specially designed for the use of free, immobilised, or carrier-bound enzymes, e.g. apparatus containing a fluidised bed of immobilised enzymes
C12M 1/00 - Apparatus for enzymology or microbiology
C12N 9/42 - Hydrolases (3.) acting on glycosyl compounds (3.2) acting on beta-1, 4-glucosidic bonds, e.g. cellulase
127281534144 alkyl; X- is a halide anion selected from the group consisting of bromide (Br-), chloride (Cl-) and iodide (I-); f is a fraction ranging from about 0.2 to 0.5; g is a fraction ranging from about 0.7 to about 0.95; and n is an integer ranging from about 20 to about 6000 and a solvent-free method of producing the aqueous antimicrobial dispersion are provided. The polymer of Formula (I) has antimicrobial activity, and an antimicrobial substrate may be provided by coating the substrate with the aqueous dispersion and curing it to crosslink the polymer to the substrate in a solvent-free manner.
A containment device includes a substantially transparent structure having a top, an open bottom with bottom edges aligned in a plane to form a planar base, and a plurality of sidewalls extending from the bottom to the top that define an interior for a patient’s head. A first sidewall has a pair of access openings for an operator’s hands, and an open end opposite the first sidewall is sized to accommodate at least a portion of the patient’s upper body when in use. The top includes a fist transparent panel extending from the first sidewall towards the open end at an upward incline relative to the plane (AA) of the base, the first transparent panel providing the operator with an undistorted and unobstructed view of the patient’s head.
Aspects of the present disclosure provide for a dissection station for a cadaver. The station includes a tray having an arrangement of ventilation openings which allow a passage of fluid from the tray and an elongate form configured to support the cadaver. The station further includes an elongate bath disposed below the tray and configured to support the tray; a drainage system including a drainage outflow from the bath; and a gas extraction system including an exhaust duct from the bath. The disclosure further provides for an installation of a dissection station which is configured to force gas from a ceiling gas insertion mechanism toward the tray and through the ventilation arrangement to the bath and from the bath through an exhaust duct extension.
NN-alkylmaleimide repeat units and repeat units selected from the group consisting of maleic anhydride repeat units, maleic acid repeat units or maleic anhydride derivative repeat units and having a narrow molecular weight distribution are provided. The terpolymers may be used to solubilize lipid bilayers to form lipid nanodiscs and isolate membrane proteins.
A method of producing a modified Saccharomyces cerevisiae yeast strain with enhanced resistance (or tolerance) to pretreatment-derived microbial inhibitors such as furans, phenolics and weak acids is provided, which comprises integrating at least one copy of the TAL1 gene and at least one copy of two or more of the FDH1, AR11 and ADH6 genes into the S. cerevisiae genome. A modified yeast strain so obtained is also provided, the modified yeast strain being capable of simultaneously overexpressing these genes relative to a yeast strain which hasn't been modified in the same manner. S. cerevisiae strains which have been modified as described herein can be used to ferment lignocellulosic hydrolysates containing pretreatment inhibitors such as furans, phenolics and weak acids. Suitable lignocellulosic hydrolysates include sugarcane bagasse (SCB) and waste streams from the pulp and paper industry, such as spent sulphite liquor (SSL).
An apparatus (30), process and ventilation system (1) are provided for insect rearing. At least one cluster (2) of one or more stacks of crates (4) are provided to contain immature phases of insects. Each cluster is provided with a ventilation system including air-permeable curtains (12) that form an enclosure (6) around the cluster. A top opening (8) is provided which cooperates with a fan (10) for sucking air out. The process includes the steps of placing immature phases of insects and feed into crates (4). The crates are stacked onto trolleys (18) and arranged into a cluster beneath a fan (10). An enclosure (6) is formed around the cluster (2) with air-permeable curtains (12), the enclosure (6) having a top opening (8) which cooperates with the fan (10). The enclosure (6) is ventilated by operating the fan (10) to suck air out of the enclosure.
An anthropometric growth apparatus (101, 201, 501) for measuring the anthropometry of an infant is provided. The apparatus comprises a base (103, 203, 503) with a digital scale assembly (105, 205, 505) mounted to the base and configured to measure a weight of the infant. A digital length measurement assembly (107, 207, 507) is mounted to the base and configured to measure a length of the infant. A head circumference measurement assembly (109, 209, 509) is mounted to the base and includes an array of distance sensors (111, 211, 511) provided on a support (113, 213, 513) configured to position the array of distance sensors at a selected distance from the head of the infant for non-invasive measurement of the head circumference in use. The apparatus may further be used for body composition and gestational age determination.
The present invention relates to a method for producing a cutinase-like enzyme (CLE1) in a S. cerevisiae cell, comprising heterologously expressing a codon-optimised nucleic acid encoding the cutinase-like enzyme and operably linked to an engineered promoter in the cell. The invention further relates to recombinant S. cerevisiae cells capable of heterologously expressing the cutinase-like enzyme and to cutinase-like enzyme obtained from the cells or prepared by the methods. Also provided are methods of preparing a cell-free supernatant comprising a cutinase-like enzyme from the recombinant S. cerevisiae cells and the use thereof or of the recombinant S. cerevisiae cells in hydrolysing bioplastic polymers.
A method of diagnosing tuberculosis (TB) is provided. The method comprising the step of testing a biological sample from the subject for the presence of CC4 and at least one other biomarker selected from the group consisting of CC4b, procalcitonin, CCL1, apolipoprotein-CIII, RANTES and TNF-α. A device, kit and computer-implemented method for diagnosing (and optionally also treating) TB are also provided.
SOUTH AFRICAN MEDICAL RESEARCH COUNCIL (South Africa)
Inventor
Dijkstra, Stephan
Theron, Grant De Vos
Nieuwoudt, Martinus Johannes
Venter, Rouxjeane
Warren, Robin Mark
Abstract
An extraction device assembly for extracting a sample from a sample-containing chamber of a nucleic acid amplification cartridge is provided. The assembly has a cartridge interface forming a receptacle configured to at least partially fit the sample-containing chamber therein. The cartridge interface has an aperture configured to at least partially expose the sample-containing chamber, and a collection interface having an aperture configured to at least partially align with the cartridge interface aperture and with the sample-containing chamber positioned at least partially between them. The collection interface aperture is in fluid communication with a collector. The extraction device assembly is operable to fit the sample-containing chamber in the receptacle of the cartridge interface and guide a piercing tool into the cartridge interface aperture to pierce the sample-containing chamber and liberate a sample contained therein for transferral to the collector.
A method of determining the location and quantity of mitochondrial fission, fusion and depolarisation events that occur in a cell is provided. Using a three-dimensional time lapse image sequence of a cell, the method identifies which of the mitochondria in a cell had depolarised or undergone fission or fusion in the interval between the acquisition of the earlier and later images, indicates the locations of the fission, fusion and depolarisation events, and generates a count of the number of mitochondrial fission, fusion and/or depolarisation events. The method can be used to diagnose a disease or condition associated with mitochondrial dysfunction, such as neurodegenerative disease, cancer or ischaemic heart disease. The method can further be used to screen a compound or composition for use in preventing or treating a disease or condition associated with mitochondrial dysfunction. The method can be computer-implemented, and a computer program product is provided.
The present invention relates to methods of increasing the cellular concentration of Interferon Induced Protein with Tetratricopeptide repeats (IFIT) polypeptides in a cell infected with a mycobacterium. The method includes the introduction of exogenous IFIT polypeptides or expression vectors encoding the exogenous IFIT polypeptides into the cell, wherein increasing the cellular concentration of the IFIT polypeptide reduces the number of viable mycobacteria in the cell. The invention also relates to methods of treatment and uses of IFIT proteins and uses of vectors encoding IFIT proteins.
A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
C12N 15/79 - Vectors or expression systems specially adapted for eukaryotic hosts
C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
A61P 31/06 - Antibacterial agents for tuberculosis
42.
SYSTEM AND PROCESS FOR DESULPHURISATION OF PYROLYSIS FEEDSTOCKS
22S from a sulphur-containing organic feedstock such as scrap tyres. The desulphurisation system comprises an inert heating reactor or chamber, an inert gas delivery system and a vapour transfer component. The heating reactor is configured to heat the sulphur-containing feedstock to a desulphurisation temperature of 300 ºC or lower under an inert atmosphere, which liberates a volatile component containing the sulphur compound. The vapour transfer component transfers the volatile component downstream while leaving behind a desulphurised feedstock residue. The gas delivery system is connected to the heating reactor and provides the inert atmosphere in the heating reactor. The invention extends to a pyrolysis reaction system which includes the described desulphurisation system and a pyrolysis reactor configured to perform a pyrolysis reaction of the residue, typically at a temperature higher than the desulphurisation temperature.
C10B 53/07 - Destructive distillation, specially adapted for particular solid raw materials or solid raw materials in special form of synthetic polymeric materials, e.g. tyres
C10G 1/10 - Production of liquid hydrocarbon mixtures from oil shale, oil-sand, or non-melting solid carbonaceous or similar materials, e.g. wood, coal from rubber or rubber waste
C10B 57/08 - Non-mechanical pretreatment of the charge
C10B 57/02 - Multi-step carbonising or coking processes
C10B 27/00 - Arrangements for withdrawal of the distillation gases
C10B 57/14 - Features of low-temperature carbonising processes
A co-culture bioreactor (101) is provided and comprises at least two chambers (103, 105), each configured to house a distinct cell type in a shared culture medium and each having an inlet (123, 125) and an outlet (115, 117) for the shared culture medium. A selectively permeable membrane (107, 109) is associated with each of the at least two chambers and in fluid communication with the outlet of one chamber and an inlet of one or more other chambers. Each of the selectively permeable membranes is individually configured to prevent permeation of cells from the chamber it is associated with into the one or more other chambers whilst allowing culture medium and selected biomolecules to permeate therethrough. A pump (111, 113) is associated with each of the at least two chambers and is configured to circulate culture medium through the selectively permeable membrane and between the at least two chambers.
The present invention is directed to a yeast strain, or strains, secreting a full suite, or any subset of that full suite, of enzymes to hydrolyze corn starch, corn fiber, lignocellulose, (including enzymes that hydrolyze linkages in cellulose, hemicellulose, and between lignin and carbohydrates) and to utilize pentose sugars (xylose and arabinose). The invention is also directed to the set of proteins that are well expressed in yeast for each category of enzymatic activity. The resulting strain, or strains can be used to hydrolyze starch and cellulose simultaneously. The resulting strain, or strains can be also metabolically engineered to produce less glycerol and uptake acetate. The resulting strain, or strains can also be used to produce ethanol from granular starch without liquefaction. The resulting strain, or strains, can be further used to reduce the amount of external enzyme needed to hydrolyze a biomass feedstock during an Simultaneous Saccharification and Fermentation (SSF) process, or to increase the yield of ethanol during SSF at current saccharolytic enzyme loadings. In addition, multiple enzymes of the present invention can be co-expressed in cells of the invention to provide synergistic digestive action on biomass feedstock. In some aspects, host cells expressing different heterologous saccharolytic enzymes can also be co-cultured together and used to produce ethanol from biomass feedstock.
Copolymers comprising optionally at least partially substituted styrene monomer units and maleic anhydride derivative monomer units in which substantially all the maleic anhydride derivative monomer units include a zwitterionic carboxybetaine moiety are provided. The zwitterionic copolymers may be used to solubilize lipid bilayers to form lipid nanodiscs and isolate membrane proteins.
An apparatus (100, 200) and system (300) for measuring and monitoring fouling parameters in a fluid are provided. The apparatus (100, 200) includes a conduit (103, 203) within a housing (101, 201), wherein at least a portion of the conduit provides a carbon dioxide permeable membrane through which carbon dioxide in the fluid can permeate in use. A carbon dioxide sensor (113, 213) within the housing is configured to measure carbon dioxide levels at the sensor. The housing further includes a light source (115, 215) that irradiates a portion of the conduit and a light sensor (117, 217) that is configured to measure light transmitted through or reflected by the irradiated portion of the conduit to measure the amount of fouling material within the fluid and attached to the irradiated portion of the conduit in use.
A system and method for operations management in a workplace environment incorporating human resources in an automated environment. The system includes a network of a plurality of modular shell components with each shell component configured to include data stores and plugin software components to autonomously manage data and decisions related to the operations of a resource or an activity in an automated environment. In the network, at least one of the shell components is configured for a human resource; at least one of the shell components is configured for a non-human resource; and at least one of the shell components is configured for an activity to be carried out by a human resource or a non-human resource. Each shell component includes a communication component to communicate with one or more other shell components to provide a scalable architecture.
This invention relates to methods of diagnosing COVID-19 disease, preferably post-acute COVID-19 syndrome, in a subject using a fluorescent or microscopy detection method to detect persistent anomalous (amyloid) clotlets in the sample, wherein the presence of persistent anomalous (or amyloid) clotlets in the sample, particularly clotlets that are resistant to fibrinolysis, is indicative of either acute COVID-19 disease or post-acute COVID-19 syndrome in the subject. The invention also relates to diagnostic kits for diagnosing acute COVID-19 disease, in particular post-acute COVID-19 syndrome, in a subject based on the methods disclosed.
The invention provides a method for depolymerising a phenolic polymer, the method comprising reacting the phenolic polymer with dimethylsulphoxide (DMSO) and a hydrogen halide. The phenolic polymer may be selected from the group consisting of lignin and derivatives thereof. The hydrogen halide may be HBr. The quantity of hydrogen halide per gram of phenolic polymer may be from 30 mmoles to 70 mmoles. The quantity of DMSO per gram of phenolic polymer may be from 0.1 mole to 1 mole. The reaction may be performed at a temperature of from 100 to 120° C. The reaction may be carried out for between 10 h and 14 h. The product of the reaction may comprise vanillin.
C07C 45/59 - Preparation of compounds having C=O groups bound only to carbon or hydrogen atomsPreparation of chelates of such compounds from heterocyclic compounds with oxygen as the only hetero atom in five-membered rings
C07C 27/00 - Processes involving the simultaneous production of more than one class of oxygen-containing compounds
C07C 37/54 - Preparation of compounds having hydroxy or O-metal groups bound to a carbon atom of a six-membered aromatic ring by reactions decreasing the number of carbon atoms by splitting polyaromatic compounds, e.g. polyphenolalkanes by hydrolysis of lignin or sulfite waste liquor
C07C 45/67 - Preparation of compounds having C=O groups bound only to carbon or hydrogen atomsPreparation of chelates of such compounds by reactions not involving the formation of C=O groups by isomerisationPreparation of compounds having C=O groups bound only to carbon or hydrogen atomsPreparation of chelates of such compounds by reactions not involving the formation of C=O groups by change of size of the carbon skeleton
C07G 1/00 - Low-molecular-weight derivatives of lignin
C08J 11/28 - Recovery or working-up of waste materials of polymers by chemically breaking down the molecular chains of polymers or breaking of crosslinks, e.g. devulcanisation by treatment with organic material by treatment with organic compounds containing nitrogen, sulfur or phosphorus
C08L 97/00 - Compositions of lignin-containing materials
C10G 1/00 - Production of liquid hydrocarbon mixtures from oil shale, oil-sand, or non-melting solid carbonaceous or similar materials, e.g. wood, coal
50.
SCHIFF BASE FUNCTIONALISED METAL NANOPARTICLE CATALYSTS AND THEIR USE IN OLEFIN POLYMERIZATION
This invention relates to novel bidentate N,N or N,O donor Schiff base functionalised metal nanoparticle catalysts and their use in a method for the polymerization of olefins including norbornene, for example. The method for the polymerization of olefins according to the invention comprises the use of the novel nanocatalysts together with a co-catalyst or catalyst activator, which may be methylaluminoxane or modified methylaluminoxane. The nanoparticle catalysts of the invention are surprisingly efficient at favourably mild reaction conditions.
C08F 132/08 - Homopolymers of cyclic compounds containing no unsaturated aliphatic radicals in a side chain, and having one or more carbon-to-carbon double bonds in a carbocyclic ring system having condensed rings
51.
Dispenser, dispensing system, and dispensing method
A dispenser, a dispensing system and a dispensing method are disclosed. A plurality of dispensers may be implemented. The dispenser includes a flexible container having a top and a bottom and capable of holding a product therein, the flexible container including top and bottom openings. A rigid support structure that supports the flexible container is provided. A moveable dispensing arm that operatively facilitates product dispensing is also provided. The moveable dispensing arm is operable between a dispensing condition and a retaining condition, and it includes a pinching edge which is configured to pinch the flexible container shut in either the dispensing condition or the retaining condition of the dispensing arm.
A47J 47/01 - Kitchen containers, stands or the like, not provided for in other groups of this subclassCutting-boards, e.g. for bread with dispensing devices
B65D 83/06 - Containers or packages with special means for dispensing contents for dispensing powdered or granular material
52.
Method and system for visualising colocalised fluorescence signals
A computer-implemented method and a system are provided for visualising colocalised fluorescence signals. The method accesses signal intensity data obtained from a first fluorescence channel and a second fluorescence channel in which the signal intensity data is associated with voxels in an image. A regression factor on the signal intensity data is calculated to generate a regression parameter corresponding to a degree of correlation between the signal intensity data obtained from the first and second fluorescence channels The signal intensity data is mapped to the regression parameter and colourmap values are assigned to each voxel based on the mapped signal intensity data in which colourmap values of voxels embodying poorly correlated signal intensity data are reduced. The method renders the voxels in the image in colours according to their colourmap values to visualise colocalisation in the image.
This invention relates to compounds that are 4'-substituted analogues of the flavonol Fisetin. In particular, the invention relates to such compounds wherein the 4' position on the B-ring is substituted with a ring deactivating group which has a para-Hammett constant greater than zero, and the use of these compounds in the treatment of cancer, including epithelial cancers.
C07D 311/30 - Benzo [b] pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 4 with aromatic rings attached in position 2 or 3 with aromatic rings attached in position 2 only not hydrogenated in the hetero ring, e.g. flavones
A61K 31/352 - Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. cannabinols, methantheline
54.
FLUORESCENT FUSION BASED HETEROLOGOUS PEPTIDE PRODUCTION
The present invention relates to a method of producing a heterologous polypeptide of interest in a host cell, wherein the method comprises expressing a fusion protein comprising the heterologous polypeptide of interest and a fluorescent fusion partner in a host cell modified to include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein is under control of an RNA thermometer. Also provided are E. coli cells which express the fusion protein and include a nucleic acid encoding a lytic protein operably linked to a promoter, wherein translation of the lytic protein regulated by an RNA thermometer.
Pseudomonas aeruginosa, Bacillus amyloliquefaciensSerratia marcescensSerratia marcescens. The invention also provides articles of manufacture which include substrate materials that are at least partially coated with biosurfactants. The substrate materials and biosurfactants may be as described above.
The present invention relates to a bioreactor for the catalytic conversion of a substrate to a product using an immobilized enzyme. The immobilized enzyme is a histidine tagged enzyme, which binds to a nickel-nanoparticle coated cellulose matrix which is housed within the bioreactor. The invention also relates to methods of producing products by enzymatic catalysis using the bioreactor of the invention.
Lactobacillus crispatus is provided. The probiotic composition stimulates the immune response of chickens without negatively affecting growth performance. The probiotic composition can be added to poultry feed to improve the health and performance of chickens, and can be used as a replacement for antibiotic supplementation.
A method (1200) and apparatus (10, 50) are provided for determining characteristics of a photovoltaic (PV) power source. An inductor (20) and a capacitor (22) of a resonant circuit (12, 52) are connected (1202) in parallel with an output of the PV power source (3), thereby causing (1204) a transient oscillation of an output voltage and output current of the PV power source. Values of the output voltage and output current of the PV power source are sampled (1206) during the transient oscillation, and the sampled voltage and current values are usable to determine (1208) at least a section of a current-voltage (I-V) curve of the PV power source.
A containment device (10) includes a substantially transparent structure (12) having a top (14), open bottom (16) with bottom edges (18) aligned in a plane to form a planar base (20), and a plurality of sidewalls (22, 24, 26) extending from the bottom (16) to the top (14) that define an interior (28) for a patient's head (32). A first sidewall (22) has a pair of access openings (34) for an operator's hands, and an open end (44) opposite the first sidewall (22) is sized to accommodate at least a portion of the patient's upper body when in use. The top includes a fist transparent panel (48) extending from the first sidewall (22) towards the open end (44) at an upward incline relative to the plane (AA) of the base (20), the first transparent panel (48) providing the operator with an undistorted and unobstructed view of the patient's head.
Saccharomyces cerevisiaeFDH1, ARI1ADH6S. cerevisiae S. cerevisiaeS. cerevisiae strains which have been modified as described herein can be used to ferment lignocellulosic hydrolysates containing pretreatment inhibitors such as furans, phenolics and weak acids. Suitable lignocellulosic hydrolysates include sugarcane bagasse (SCB) and waste streams from the pulp and paper industry, such as spent sulphite liquor (SSL).
A method of determining the location and quantity of mitochondrial fission, fusion and depolarisation events that occur in a cell is provided. Using a three-dimensional time lapse image sequence of a cell, the method identifies which of the mitochondria in a cell had depolarised or undergone fission or fusion in the interval between the acquisition of the earlier and later images, indicates the locations of the fission, fusion and depolarisation events, and generates a count of the number of mitochondrial fission, fusion and/or depolarisation events. The method can be used to diagnose a disease or condition associated with mitochondrial dysfunction, such as neurodegenerative disease, cancer or ischaemic heart disease. The method can further be used to screen a compound or composition for use in preventing or treating a disease or condition associated with mitochondrial dysfunction. The method can be computer-implemented, and a computer program product is provided.
Methods, devices, kits and computer-implemented methods for diagnosing (and optionally treating) tuberculous meningitis (TBM) are provided. In one embodiment, the method comprises testing a cerebrospinal fluid (CSF) sample from a subject suspected of having TBM for the presence of MPO and at least two other biomarkers, at least one of the other biomarkers being selected from the group consisting of IFN-γ, sICAM-1, VEGF-A and CXCL8. For example, the method can comprise testing the sample for MPO, IFN-γ and VEGF-A or for MPO, IFN-γ, sICAM-1 and CXCL8. In another embodiment, the method comprises testing a blood sample from a subject suspected of having TBM for the presence of at least one biomarker selected from the group consisting of adipsin (complement factor D), Ab42 and IL-10, and at least two other biomarkers. In one example, the method comprises testing the sample for the presence of adipsin (complement factor D), Ab42 and EL-10.
C12Q 1/70 - Measuring or testing processes involving enzymes, nucleic acids or microorganismsCompositions thereforProcesses of preparing such compositions involving virus or bacteriophage
G01N 33/68 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing involving proteins, peptides or amino acids
A61B 10/00 - Instruments for taking body samples for diagnostic purposesOther methods or instruments for diagnosis, e.g. for vaccination diagnosis, sex determination or ovulation-period determinationThroat striking implements
A method for treating a subject suffering from Alzheimer's disease is provided. The method includes administering to the subject a therapeutically effective amount of lipopolysaccharide-binding protein (LBP). A composition including a therapeutically effective amount of LBP is also provided.
A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
A method, device and system for determining autophagic flux are claimed. The levels of proteins which change with increased or decreased autophagy are determined in a sample. The change in the level of each protein is quantified in order to obtain the autophagic flux. This can be compared to a sample flux range associated with autophagy dysfunction or ageing patterns. Diseases or conditions which may be diagnosed include neurodegenerative conditions such as Alzheimer's disease and dementia, cancer, heart conditions, immune conditions or aging-related conditions. The device for determining autophagic flux comprises a housing, receiving zones configured for receiving a substrate and a biological sample, and a set of electrodes for each receiving zone. The device is connectable to circuitry that determines an electrical property of each substrate and uses this to determine the autophagic flux.
The present invention relates to methods of increasing the cellular concentration of Interferon Induced Protein with Tetratricopeptide repeats (IFIT) polypeptides in a cell infected with a mycobacterium. The method includes the introduction of exogenous IFIT polypeptides or expression vectors encoding the exogenous IFIT polypeptides into the cell, wherein increasing the cellular concentration of the IFIT polypeptide reduces the number of viable mycobacteria in the cell. The invention also relates to methods of treatment and uses of IFIT proteins and uses of vectors encoding IFIT proteins.
C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
A61P 31/06 - Antibacterial agents for tuberculosis
A needle is provided that has terminals located at or near its tip. The terminals are connectable to an impedance calculating circuit configured to enable the impedance calculating circuit to apply an alternating current input electrical signal to the terminals. The terminals are further configured to enable the impedance calculating circuit to measure a resultant electrical signal and calculate an impedance of biological tissue surrounding the tip. The needle may further include light transmitting media, that extends along the needle, and that is connectable to a light circuit. The light circuit may include an emitter/detector pair for transmitting light from the emitter, along the media, and emitting the light from the tip. A reflection of the emitted light may be transmitted from the tip to the detector and the light circuit may calculate the light absorption of the tissue.
D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5′ UAAACAAUCGCAAGAAGCUGA 3′ (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5′ AGCUUCUUGCGAUUGUUUAAG 3′ (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.
A method of detecting inflammation in a subject is provided. The method comprises determining a quantity of amyloid present in fibrin(ogen) protein in a blood sample obtained from the subject, and assigning a level of inflammation in the subject based on the quantity of fibrin(ogen) amyloid determined. A method of determining an effect of a therapeutic treatment on a subject by comparing a pre-treatment level of inflammation with a post-treatment level is further provided.
A computer-implemented method and a system are provided for visualising colocalised fluorescence signals. The method accesses signal intensity data obtained from a first fluorescence channel and a second fluorescence channel in which the signal intensity data is associated with voxels in an image. A regression factor on the signal intensity data is calculated to generate a regression parameter corresponding to a degree of correlation between the signal intensity data obtained from the first and second fluorescence channels. The signal intensity data is mapped to the regression parameter and colourmap values are assigned to each voxel based on the mapped signal intensity data in which colourmap values of voxels embodying poorly correlated signal intensity data are reduced. The method renders the voxels in the image in colours according to their colourmap values to visualise colocalisation in the image.
The invention provides a method for depolymerising a phenolic polymer, the method comprising reacting the phenolic polymer with dimethylsulphoxide (DMSO) and a hydrogen halide. The phenolic polymer may be selected from the group consisting of lignin and derivatives thereof. The hydrogen halide may be HBr. The quantity of hydrogen halide per gram of phenolic polymer may be from 30 mmoles to 70 mmoles. The quantity of DMSO per gram of phenolic polymer may be from 0.1 mole to 1 mole. The reaction may be performed at a temperature of from 100 to 120 °C. The reaction may be carried out for between 10 h and 14 h. The product of the reaction may comprise vanillin.
C07C 27/00 - Processes involving the simultaneous production of more than one class of oxygen-containing compounds
C07C 45/59 - Preparation of compounds having C=O groups bound only to carbon or hydrogen atomsPreparation of chelates of such compounds from heterocyclic compounds with oxygen as the only hetero atom in five-membered rings
C07C 47/575 - Compounds having —CHO groups bound to carbon atoms of six-membered aromatic rings containing ether groups, groups, groups, or groups
C07C 47/565 - Compounds having —CHO groups bound to carbon atoms of six-membered aromatic rings containing hydroxy groups all hydroxy groups bound to the ring
C07C 37/54 - Preparation of compounds having hydroxy or O-metal groups bound to a carbon atom of a six-membered aromatic ring by reactions decreasing the number of carbon atoms by splitting polyaromatic compounds, e.g. polyphenolalkanes by hydrolysis of lignin or sulfite waste liquor
C07C 43/23 - Ethers having an ether-oxygen atom bound to a carbon atom of a six-membered aromatic ring containing hydroxy or O-metal groups
C07G 1/00 - Low-molecular-weight derivatives of lignin
C08L 97/00 - Compositions of lignin-containing materials
C08J 11/16 - Recovery or working-up of waste materials of polymers by chemically breaking down the molecular chains of polymers or breaking of crosslinks, e.g. devulcanisation by treatment with inorganic material
C08J 11/28 - Recovery or working-up of waste materials of polymers by chemically breaking down the molecular chains of polymers or breaking of crosslinks, e.g. devulcanisation by treatment with organic material by treatment with organic compounds containing nitrogen, sulfur or phosphorus
73.
METHODS AND SYSTEMS FOR CONTROLLING TEMPERATURE IN A WATER HEATER
Systems and methods are disclosed for controlling temperature in a water heater (110, 210, 410, 12.1 to 12.n). A heating element (118, 218, 418, 14.1 to 14.n) heats water therein. Temperature of water is sensed with a temperature sensor (124, 224, 424, 270, 17.1 to 17.n). If an amount of available electrical power supplied by a first power source (123, 223, 423, 20) is sufficient to drive the heating element, the heating element is driven by applying power from the first power source to heat the water up to a first temperature threshold. If the amount of power from the first power source is not available or insufficient, the heating element may be driven with power supplied by a second power source (125, 225, 425, 22) to heat the water up to a second temperature threshold that is lower than the first temperature threshold.
KING ABDULLAH UNIVERSITY OF SCIENCE AND TECHNOLOGY (Saudi Arabia)
STELLENBOSCH UNIVERSITY (South Africa)
Inventor
Kosel, Jürgen
Swanepoel, Liam
Fourie, Pieter
Abstract
A subcutaneous medical device system includes a subcutaneous medical device, a magnetic element arranged on a portion of the subcutaneous medical device, the magnetic element including at least two poles, and a magnetic detector arranged spaced apart from the magnetic element and outside of a patient. The magnetic detector includes a single magnetic sensor and a processor coupled to the single magnetic sensor. The processor is programmed to determine a position of the portion of the subcutaneous medical device within the patient based on a static magnetic flux measurement of the magnetic element by the single magnetic sensor without externally applying an external magnetic field to the magnetic element.
A computer-implemented method and system for screening for and monitoring a condition are provided. In a method conducted at a communication device a virtual environment is provided which is output to a user via one or more output components of the communication device. The user is required to interact with the environment by way of a series of instructions input into the communication device. The virtual environment includes a number of environment-based discriminators which, based on a user's interaction relative thereto, facilitate discrimination between a user with and without a condition. Data points relating to the user's interaction in relation to each of the number of environment-based discriminators are recorded and compiled into a payload including a user identifier. The payload is output for input into a machine learning component configured to discriminate between users with and without the condition by identifying patterns in the data points.
A61B 5/00 - Measuring for diagnostic purposes Identification of persons
G16H 50/50 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for simulation or modelling of medical disorders
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
G16H 50/70 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for mining of medical data, e.g. analysing previous cases of other patients
G16H 10/20 - ICT specially adapted for the handling or processing of patient-related medical or healthcare data for electronic clinical trials or questionnaires
A heat transfer device (100) includes an inner tube (102) mounted within a tubular chamber (104) of a heat exchanger (106). The hollow tubular chamber (104) has a closed end (108) with inwardly sloping inner surfaces (110) and the inner tube (102) has an open end (112) that terminates short of the closed end (108). A diffuser (114) is provided and is shaped such that an operatively front part (116) thereof substantially conforms to a shape of the inner surfaces (110) of the closed end (108) so as to form a narrow flow passageway (118) between the diffuser (114) and the inner surfaces (110) at the closed end (108), and an operatively back part (120) of the diffuser (114) slopes towards the inner tube (102) and away from its open end (112) to form a diffusion zone (122). Heat transfer assemblies utilising the heat transfer device (100) are also disclosed.
F24S 20/20 - Solar heat collectors for receiving concentrated solar energy, e.g. receivers for solar power plants
F24S 23/71 - Arrangements for concentrating solar rays for solar heat collectors with reflectors with parabolic reflective surfaces
F24S 70/65 - Combinations of two or more absorbing elements
F28D 7/12 - Heat-exchange apparatus having stationary tubular conduit assemblies for both heat-exchange media, the media being in contact with different sides of a conduit wall the conduits being arranged one within the other, e.g. concentrically the surrounding tube being closed at one end, i.e. return type
F28F 13/06 - Arrangements for modifying heat transfer, e.g. increasing, decreasing by affecting the pattern of flow of the heat-exchange media
A method and system for pollinating a target crop by bees is provided. The method comprises the steps of removing a number of worker bees from a reproductive bee colony and housing the worker bees in a portable pollination hive with no queen bee. The system includes a production hive housing a reproductive bee colony with a queen bee for producing worker bees and a pollination hive without a queen bee and housing a selected number of worker bees for pollinating the target crop. The pollination hive includes a portable hive and a worker bee colony without a queen bee housed within the hive.
A method, device and system for determining autophagic flux are claimed. The levels of proteins which change with increased or decreased autophagy are determined in a sample. The change in the level of each protein is quantified in order to obtain the autophagic flux. This can be compared to a sample flux range associated with autophagy dysfunction or ageing patterns. Diseases or conditions which may be diagnosed include neurodegenerative conditions such as Alzheimer's disease and dementia, cancer, heart conditions, immune conditions or aging-related conditions. The device for determining autophagic flux comprises a housing, receiving zones configured for receiving a substrate and a biological sample, and a set of electrodes for each receiving zone. The device is connectable to circuitry that determines an electrical property of each substrate and uses this to determine the autophagic flux.
Methods, devices, kits and computer-implemented methods for diagnosing (and optionally treating) tuberculous meningitis (TBM) are provided. In one embodiment, the method comprises testing a cerebrospinal fluid (CSF) sample from a subject suspected of having TBM for the presence of MPO and at least two other biomarkers, at least one of the other biomarkers being selected from the group consisting of IFN-γ, sICAM-1, VEGF-A and CXCL8. For example, the method can comprise testing the sample for MPO, IFN-γ and VEGF-A or for MPO, IFN-γ, sICAM-1 and CXCL8. In another embodiment, the method comprises testing a blood sample from a subject suspected of having TBM for the presence of at least one biomarker selected from the group consisting of adipsin (complement factor D), Ab42 and IL-10, and at least two other biomarkers. In one example, the method comprises testing the sample for the presence of adipsin (complement factor D), Ab42 and IL-10.
There is provided a thermal energy storage facility comprising a packed bed formed by a pile of elements. The packed bed includes sides that slope from a top of the pile to a bottom of the pile at their natural angle of repose. A duct is provided and has a heat exchange end in fluid communication with the packed bed at a heat exchange zone and an opposite fluid supply end. The duct enables a working fluid at elevated temperature to be introduced into the packed bed during a charge cycle. The duct further enables the working fluid to be conveyed through a charged packed bed during a discharge cycle. A barrier extends across at least a major portion of the sloping sides of the packed bed to inhibit the movement of the working fluid therethrough.
A needle is provided that has terminals located at or near its tip. The terminals are connectable to an impedance calculating circuit configured to enable the impedance calculating circuit to apply an alternating current input electrical signal to the terminals. The terminals are further configured to enable the impedance calculating circuit to measure a resultant electrical signal and calculate an impedance of biological tissue surrounding the tip. The needle may further include light transmitting media, that extends along the needle, and that is connectable to a light circuit. The light circuit may include an emitter/detector pair for transmitting light from the emitter, along the media, and emitting the light from the tip. A reflection of the emitted light may be transmitted from the tip to the detector and the light circuit may calculate the light absorption of the tissue.
A61M 5/32 - NeedlesDetails of needles pertaining to their connection with syringe or hubAccessories for bringing the needle into, or holding the needle on, the bodyDevices for protection of needles
12122 is a hydrolase enzyme is provided. The conjugate is characterised in that in at least some of subunits n, the hydrolase enzyme is an amylase, and in other subunits n, the hydrolase enzyme is a protease. The conjugate may be suitable for use in a biotechnological process or for protecting a surface from biofouling.
SEATTLE CHILDREN’S HOSPITAL DOING BUSINESS AS SEATTLE CHILDREN’S RESEARCH INSTITUTE (USA)
MAX-PLANCK-GESELLSCHAFT ZUR FOERDERUNG DER WISSENSCHAFTEN E.V (Germany)
UNITED KINGDOM RESEARCH AND INNOVATION (United Kingdom)
Inventor
Suliman, Sara
Thompson, Ethan, Greene
Sutherland, Jayne, Suzanne
Kaufmann, Stefan H.E.
Scriba, Thomas, Jens
Zak, Daniel, Edward
Walzl, Gerhard
Abstract
The invention provides a gene signature for use in determining a likelihood of a latent tuberculosis (TB) infection in a subject transitioning to active TB disease. The gene signature comprises at least SEPT4 and BLK, and optionally also GAS6 and/or CD1C. Expression levels of these genes are detected in a sample from the subject, and the ratios of expression of at least two of the above genes are calculated (e.g. SEPT4:BLK, SEPT4:CD1C, GAS6:BLK and/or GAS6:CD1C). A score is assigned to each ratio, the score being indicative of the likelihood of the latent TB infection transitioning into active TB disease, based on the ratio for the respective gene pair. The subject can be identified as having a latent TB infection that is likely to transition into active TB disease or that is not likely to transition into active TB disease based on the score or on the average of the scores.
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
noxia cprr1-8 noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5' UAAACAAUCGCAAGAAGCUGA 3' (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5' AGCUUCUUGCGAUUGUUUAAG 3' (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.
C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
C12N 15/82 - Vectors or expression systems specially adapted for eukaryotic hosts for plant cells
A01N 57/16 - Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
A computer-implemented method and system for screening for and monitoring a condition are provided. In a method conducted at a communication device a virtual environment is provided which is output to a user via one or more output components of the communication device. The user is required to interact with the environment by way of a series of instructions input into the communication device. The virtual environment includes a number of environment-based discriminators which, based on a user's interaction relative thereto, facilitate discrimination between a user with and without a condition. Data points relating to the user's interaction in relation to each of the number of environment-based discriminators are recorded and compiled into a payload including a user identifier. The payload is output for input into a machine learning component configured to discriminate between users with and without the condition by identifying patterns in the data points.
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
G16H 50/30 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for calculating health indicesICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for individual health risk assessment
G16H 20/70 - ICT specially adapted for therapies or health-improving plans, e.g. for handling prescriptions, for steering therapy or for monitoring patient compliance relating to mental therapies, e.g. psychological therapy or autogenous training
86.
METHODS, SYSTEMS AND DEVICES FOR DETECTING INFLAMMATION
A method, system, test strip, point-of-care device and computer-implemented method for detecting a level of inflammation in a subject is provided. The level of inflammation is detected by contacting a biological sample obtained from the subject with a serum amyloid A (SAA) capture agent. The capture agent is secured to a substrate and is configured to emit a signal upon binding to SAA. The signal is detected and a result indicating the level of inflammation in the subject is output.
A method of detecting inflammation in a subject is provided. The method comprises determining a quantity of amyloid present in fibrin(ogen) protein in a blood sample obtained from the subject, and assigning a level of inflammation in the subject based on the quantity of fibrin(ogen) amyloid determined. A method of determining an effect of a therapeutic treatment on a subject by comparing a pre-treatment level of inflammation with a post-treatment level is further provided.
An adjustable furniture article (1) comprising a base member (3), a top member (5) and a retaining and adjustment arrangement. The top member (5) provides a working surface (23) and the retaining and adjustment arrangement are configured operatively to retain the top member (5) relative to the base member (3) in a position which is above the base member (3) and at which an angle between the working surface (23) and the horizontal is acute. The retaining and adjustment arrangement provides an adjustment mechanism configured to enable adjustment of the height of the top member (23) relative to the base member (3) between limits selected to enable adjustment for use of the furniture article (1) as a seat and use of the furniture article as a standing desk.
A shark barrier that comprises an anchoring assembly having a pair of anchors (9) with a flexible connecting element (11) extending between the anchors. The shark barriers also includes multiple spaced apart buoyant resiliently flexible elongate members (15) that are secured at one end along a length of the connecting element of the anchoring assembly to operatively extend generally upwardly from the connecting element. The buoyant members comprise an elongate flexible spine (32) that extends through a series of tubular members (38).
E02B 1/00 - Equipment or apparatus for, or methods of, general hydraulic engineering
B63C 9/05 - Shark screens, e.g. buoyant means combined with means to surround or otherwise enclose the user
A01M 29/30 - Scaring or repelling devices, e.g. bird-scaring apparatus preventing or obstructing access or passage, e.g. by means of barriers, spikes, cords, obstacles or sprinkled water
A method for measuring autophagosome flux is provided. The autophagosome pool size in a single cell is quantified, where the pool size is the total number of autophagosomes in the cell. Fusion between the autophagosomes and lysosomes in the cell is then inhibited. The autophagosome pool size is quantified over one or more time points after fusion has been inhibited, and the autophagosome flux is calculated as the initial rate of change of the autophagosome pool size at the time point after fusion has been inhibited. The method can be used to determine basal autophagosome flux, whether a cell is diseased or dysfunctional, or to diagnose a subject with a disease, disorder or dysfunction. The transition time, the time required to clear an autophagosome pool, can also be derived from the autophagosome flux. A molecule can also be characterized according to its ability to modulate autophagosome flux in a cell.
A probiotic composition comprising Bacillus amyloliquefaciens, Enterococcus faecalis, Lactobacillus salivarius, Lactobacillus johnsonii, Lactobacillus gallinarum and Lactobacillus crispatus is provided. The probiotic composition stimulates the immune response of chickens without negatively affecting growth performance. The probiotic composition can be added to poultry feed to improve the health and performance of chickens, and can be used as a replacement for antibiotic supplementation.
A device and method for use in diagnosing a medical condition are described. The device includes a casing configured for mounting a communication device on a head of a patient and providing an optical path between an eye of the patient and a display zone in which a display of the communication device operatively locates. The casing includes a lens located in the optical path and configured to facilitate focussing of the eye of the patient at the display zone. The casing includes an illumination module configured to project light onto the eye and an optical arrangement. The optical arrangement is arranged to direct light, having projected onto the eye by the illumination module and reflected by the eye, towards an opening arranged operatively to provide optical communication with a camera of the communication device, thereby to enable tracking of movement of the eye by the communication device.
A61B 3/113 - Objective types, i.e. instruments for examining the eyes independent of the patients perceptions or reactions for determining or recording eye movement
93.
LIPOPOLYSACCHARIDE-BINDING PROTEIN FOR USE IN A METHOD OF TREATING DIABETES
A method for treating a subject suffering from diabetes is provided. The method includes administering to the subject a therapeutically effective amount of lipopolysaccharide-binding protein (LBP). A composition including a therapeutically effective amount of LBP is also provided.
A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
A61P 3/10 - Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
94.
LIPOPOLYSACCHARIDE-BINDING PROTEIN FOR USE IN A METHOD OF TREATING PARKINSON'S DISEASE
A method for treating a subject suffering from Parkinson's disease is provided. The method includes administering to the subject a therapeutically effective amount of lipopolysaccharide- binding protein (LBP). A composition including a therapeutically effective amount of LBP is also provided.
A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
A method for treating a subject suffering from Alzheimer's disease is provided. The method includes administering to the subject a therapeutically effective amount of lipopolysaccharide- binding protein (LBP). A composition including a therapeutically effective amount of LBP is also provided.
A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
A non-invasive method for measuring a rifamycin antibiotic drug in a patient using spectrophotometry is provided. The method comprises directing light of known spectral characteristics at a body part such as a well-perfused appendage and measuring the spectrum of transmitted or reflected light. The method allows for the transcutaneous measuring and subsequent determination of a level of the rifamycin antibiotic drug in a patient by comparing a measured spectrum with a reference spectrum. A system, computer program product and portable device for carrying out the method of non-invasively measuring a rifamycin antibiotic drug in a patient are also provided.
A61B 5/00 - Measuring for diagnostic purposes Identification of persons
A61B 5/145 - Measuring characteristics of blood in vivo, e.g. gas concentration or pH-value
A61B 5/1455 - Measuring characteristics of blood in vivo, e.g. gas concentration or pH-value using optical sensors, e.g. spectral photometrical oximeters
A solution including an antimicrobial polymer in a polar solvent and a method of producing the solution. The polymer has the structure of Formula (I). The antimicrobial solution may be coated onto a substrate and cured to provide an antimicrobial substrate in which the polymer is covalently bonded to the substrate so that it cannot leach from the substrate.
C09D 123/36 - Coating compositions based on homopolymers or copolymers of unsaturated aliphatic hydrocarbons having only one carbon-to-carbon double bondCoating compositions based on derivatives of such polymers modified by chemical after-treatment by reaction with nitrogen-containing compounds, e.g. by nitration
C09D 5/14 - Paints containing biocides, e.g. fungicides, insecticides or pesticides
Rasamsonia emersonii) is provided. The use of the recombinant yeast in a process for producing an alcohol, in particular a biofuel, from starch or sugars is also described.
A synthetic pulmonary surfactant composition for use in the treatment of inflammatory or cell proliferation disorders of the lungs is provided. The composition comprises a lipidaceous carrier and a peptide complex of poly-L-lysine or a pharmaceutically acceptable salt thereof and poly-L- glutamic acid or poly-L-aspartic acid or a pharmaceutically acceptable salt thereof, the peptide complex having a charge-neutralised region and a positively-charged region. The synthetic pulmonary surfactant composition may be provided in an inhalable formulation. The synthetic pulmonary surfactant composition may also be combined with a drug for use in treating a lung infection, particularly a lung infection characterised by inflammation in the lungs so that the combination provides dual immunomodulatory effects.
A61K 31/5377 - 1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
A61K 31/43 - Compounds containing 4-thia-1-azabicyclo [3.2.0] heptane ring systems, i.e. compounds containing a ring system of the formula , e.g. penicillins, penems
A61K 31/431 - Compounds containing 4-thia-1-azabicyclo [3.2.0] heptane ring systems, i.e. compounds containing a ring system of the formula , e.g. penicillins, penems containing further heterocyclic ring systems, e.g. ticarcillin, azlocillin, oxacillin
A61K 31/4409 - Non-condensed pyridinesHydrogenated derivatives thereof only substituted in position 4, e.g. isoniazid, iproniazid
A61K 31/4709 - Non-condensed quinolines containing further heterocyclic rings
A61K 31/4745 - QuinolinesIsoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenanthrolines
A61K 31/7036 - Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin having at least one amino group directly attached to the carbocyclic ring, e.g. streptomycin, gentamycin, amikacin, validamycin, fortimicins
A system and method for generating radiometricaiiy corrected surface images is provided. This includes providing one or more surface images of a first resolution of a surface area in the form of digital images which has a surface image sensor measurement of an intensity value of radiation in a given wavelength band reflected from the surface for each pixel of the images. A reference image of a second resolution of a corresponding surface area is provided to the surface of the surface image. The reference image has a surface reflectance for each pixel of the reference image for an equivalent wavelength band to the given wavelength band of the surface image. A functional relationship is modelled which relates the surface image sensor measurement for pixels of a surface image to the surface reflectance for pixels of the reference image to provide an estimated surface reflectance for each pixel of the surface images.
