A rotary shaft seal including an annular body having an aperture defining a central axis and an inner surface; a shaft disposed within the aperture of the annular body; and a sealing element positioned at least partially between the shaft and the annular body, where the sealing element is configured to form a seal between the annular body and the shaft, where the sealing element includes a body having a U-shaped or a V-shaped cross-section including a plurality of lips, where at least one lip of the sealing element is fixed to at least one of the shaft or the annular body, and where a cavity exists between at least one of the plurality of lips and at least one of the shaft or the annular body.
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
F16J 15/3228 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre formée par déformation d’une bague plate
A rotary shaft seal including an annular body having an aperture defining a central axis and an inner surface; a shaft disposed within the aperture of the annular body; and a sealing element positioned at least partially between the shaft and the annular body, where the sealing element is configured to form a seal between the annular body and the shaft, where the sealing element includes a body having a U-shaped or a V-shaped cross-section including a plurality of lips, where at least one lip of the sealing element is fixed to at least one of the shaft or the annular body, and where a cavity exists between at least one of the plurality of lips and at least one of the shaft or the annular body.
F16J 15/3204 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
The present disclosure relates to a composite article that may include a structural substrate, a multilayer fluoropolymer film that can include a high-melt fluoropolymer layer and a low-melt fluoropolymer adhesion layer that may contact the structural substrate and the fluoropolymer film. The high-melt fluoropolymer layer may have a melting temperature A1 and the low-melt fluoropolymer adhesive layer may have a melting temperature A2. The melting temperature A2 may be less than the melting temperature A1.
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
B32B 7/12 - Liaison entre couches utilisant des adhésifs interposés ou des matériaux interposés ayant des propriétés adhésives
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
B32B 27/20 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers utilisant des charges, des pigments, des agents thixotropiques
An energizing element including: an energizing element body oriented about a central axis, the energizing element body defining an inner radius, IR, and an outer radius, OR, where the difference between the outer radius and the inner radius defines an adjusted width, W, of the energizing element body, where the inner radius and the outer radius determine an average radius, R, of the energizing element body about the central axis, where the energizing element body defines an aspect ratio, W/R, where W/R>0.1, where the energizing element body has a maximum linear contact length on the inner radius, LIR, where the energizing element body has a perimeter on the inner radius, PIR, and LIR/PIR>0.80, where the energizing element body has a maximum linear contact length on the outer radius, LOR, where the energizing element body has a perimeter on the outer radius, POR, and LOR/POR>0.55, and where the adjusted width is less than 5 mm.
F16J 15/02 - Joints d'étanchéité entre surfaces immobiles entre elles
F16F 1/02 - Ressorts en acier ou faits d'un autre matériau ayant une faible friction intérieureRessorts enroulés, de torsion, à lame, en forme de coupelles, à corps annulaire ou similaire, le matériau de ressort ne jouant pas de rôle
F16F 1/373 - Ressorts en matière plastique, p. ex. en caoutchoucRessorts faits d'un matériau à friction intérieure élevée caractérisés par une forme particulière
8.
ENERGIZING ELEMENT AND METHODS OF MAKING AND USING THE SAME
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
A peristaltic pump tube (100) includes a silicone composition including a base silicone material, an accelerator, a curing agent, and a catalyst, wherein the base silicone material includes a blend of a first silicone elastomer and a second silicone elastomer, wherein the first silicone elastomer has a shore A durometer that is different than a shore A durometer of the second silicone elastomer; wherein the peristaltic pump tube (100) is used with a peristaltic pump at rotator speeds of greater than 600 rotations per minute, and the silicone composition advantageously increases pump life of the peristaltic pump tube (100).
The present disclosure relates to a multilayer composite or multilayer laminate that may include a core foam layer, and a first ceramifiable barrier component contacting the core foam layer. The ceramifiable barrier component may include a ceramifiable layer. The multilayer composite may have a HBF flammability rating as measured according to ASTM D4986.
B32B 5/02 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par les caractéristiques de structure d'une couche comprenant des fibres ou des filaments
B32B 5/18 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux
B32B 5/24 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par la présence de plusieurs couches qui comportent des fibres, filaments, grains ou poudre, ou qui sont sous forme de mousse ou essentiellement poreuses une des couches étant fibreuse ou filamenteuse
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 27/12 - Produits stratifiés composés essentiellement de résine synthétique adjacente à une couche fibreuse ou filamenteuse
B32B 27/20 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers utilisant des charges, des pigments, des agents thixotropiques
C08J 9/00 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement
The present disclosure relates to a multilayer composite or multilayer laminate that may include a core foam layer, and a first ceramifiable barrier component contacting the core foam layer. The ceramifiable barrier component may include a ceramifiable layer. The multilayer composite may have a HBF flammability rating as measured according to ASTM D4986.
B32B 5/18 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 27/20 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers utilisant des charges, des pigments, des agents thixotropiques
B32B 27/28 - Produits stratifiés composés essentiellement de résine synthétique comprenant des copolymères de résines synthétiques non complètement couverts par les sous-groupes suivants
A linear motion assembly including: a first component; a second component; and a sliding member disposed between the first and second components; and a retention system adapted to retain the sliding member between the first component and the second component, where the retention system includes a retention frame and at least one spring element, where the sliding member is disposed between the retention frame and the spring element, where the spring element provides a biasing force on the sliding member.
A linear motion assembly including: a first component; a second component; and a sliding member disposed between the first and second components; and a retention system adapted to retain the sliding member between the first component and the second component, where the retention system includes a retention frame and at least one spring element, where the sliding member is disposed between the retention frame and the spring element, where the spring element provides a biasing force on the sliding member.
A seal including: an annular jacket including an annular jacket including a body including a heel, a first lip, and a second lip defining an annular recess oriented down a central axis, where the first lip is substantially parallel to the central axis, where the second lip includes an angled portion adjacent to the heel and a planar portion adjacent to the angled portion, where the angled portion forms an angle, α, with a line perpendicular to the central axis, where α is between 30 and 90°, where the heel has an axial length, LH, where the first lip has an axial length, LFL, and where LH≤3 LFL.
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
16.
SELF ENERGIZED SEAL AND METHODS OF MAKING AND USING THE SAME
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
F16J 15/3248 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques pourvus d’armatures ou de supports
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
17 - Produits en caoutchouc ou en matières plastiques; matières à calfeutrer et à isoler
Produits et services
Multimaterial plastic flexible composites, in the form of rolls and converted pieces; non-metal flexible reinforcement materials and unsupported plastic films having thermal chemical and weathering resistance and having release, friction, protection and dielectric insulation properties and multilayer composite products, composed of polymer-based plastics, flexible plastic reinforcement materials, unsupported plastic films for use in manufacturing in the mobility, industrial, communications, electronics, renewable energy, medical, safety and defense and architectural industries.
A seal including: a metal annular body oriented down a central axis, the metal annular body comprising an axially elongated heel flange, a first lip, and a second lip defining an annular recess that bisects the central axis, wherein a radial midpoint of the axially elongated heel flange is radially offset from the central axis, a radial midpoint of the first lip, and a radial midpoint of the second lip.
F16J 15/34 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par bague glissante pressée contre la face plus ou moins radiale d'une des deux parties
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
19.
MULTILAYER LAMINATE STRUCTURE AND METHOD OF FORMING THE SAME
The present disclosure relates to a multilayer laminate structure may include a glass substrate having a thickness of not greater than about 300 microns, a fluoropolymer based layer, and an encapsulant layer in contact with the fluoropolymer based layer and between the glass substrate and the fluoropolymer based layer. The encapsulant layer comprises an encapsulant component and a first encapsulant layer ultra violet (UV) absorber component.
B32B 17/10 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire comprenant du verre comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
B32B 27/18 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
B32B 27/36 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyesters
B32B 37/16 - Procédés ou dispositifs pour la stratification, p. ex. par polymérisation ou par liaison à l'aide d'ultrasons caractérisés par les propriétés des couches toutes les couches existant et présentant une cohésion avant la stratification
C08J 5/12 - Fixation d'un matériau macromoléculaire préformé au même matériau ou à un autre matériau compact, tel que du métal, du verre, du cuir, p. ex. en utilisant des adhésifs
The present disclosure relates to a multilayer laminate structure may include a glass substrate having a thickness of not greater than about 300 microns, a fluoropolymer based layer, and an encapsulant layer in contact with the fluoropolymer based layer and between the glass substrate and the fluoropolymer based layer. The encapsulant layer comprises an encapsulant component and a first encapsulant layer ultra violet (UV) absorber component.
B32B 17/10 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire comprenant du verre comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
C09K 3/10 - Substances non couvertes ailleurs pour sceller ou étouper des joints ou des couvercles
H10K 77/10 - Substrats, p. ex. substrats flexibles
A seal including: a metal annular body oriented down a central axis, the metal annular body comprising an axially elongated heel flange, a first lip, and a second lip defining an annular recess that bisects the central axis, wherein a radial midpoint of the axially elongated heel flange is radially offset from the central axis, a radial midpoint of the first lip, and a radial midpoint of the second lip.
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
17 - Produits en caoutchouc ou en matières plastiques; matières à calfeutrer et à isoler
Produits et services
Multimaterial plastic flexible composites, in the form of rolls and converted pieces; non-metal flexible reinforcement materials, unsupported plastic films having thermal chemical and weathering resistance and having release, friction, protection and dielectric insulation properties and multilayer composite products, composed of polymer-based plastics, flexible plastic reinforcement materials, unsupported plastic films for use in manufacturing in the mobility, industrial, communications, electronics, renewable energy, medical, safety and defense and architectural industries
23.
FILLER COMPOSITION, COMPOSITE MATERIAL AND COMPOSITE MATERIAL LAYER WITH THERMAL BARRIER PROPERTIES
The subject application relates to a filler composition, composite material and composite material layer with thermal barrier properties. The present disclosure relates to a filler composition may include a ceramization filler component at a content of at least about 75 wt. % and not greater than about 95 wt. % for a total weight of the filler composition, a structure promoter component at a content of at least about 0.1 wt. % and not greater than about 7.0 wt. % for a total weight of the filler composition, a flux component at a content of at least about 0.1 wt. % and not greater than about 7.0 wt. % for a total weight of the filler composition, and a flame retardant component at least about 5.0 wt. % and not greater than about 20.0 wt. % for a total weight of the filler composition.
The subject application relates to a filler composition, composite material and composite material layer with thermal barrier properties. The present disclosure relates to a filler composition may include a ceramization filler component at a content of at least about 50 wt. % and not greater than about 90 wt. % for a total weight of the filler composition, a reinforcement component at a content of at least about 0.1 wt. % and not greater than about 10.0 wt. % for a total weight of the filler composition, a flux component at a content of at least about 3.0 wt. % and not greater than about 10.0 wt. % for a total weight of the filler composition, and a flame retardant component at least about 5.0 wt. % and not greater than about 20.0 wt. % for a total weight of the filler composition.
The subject application relates to a filler composition, composite material and composite material layer with thermal barrier properties. The present disclosure relates to a filler composition may include a ceramization filler component at a content of at least about 50 wt.% and not greater than about 90 wt.% for a total weight of the filler composition, a reinforcement component at a content of at least about 0.1 wt.% and not greater than about 10.0 wt.% for a total weight of the filler composition, a flux component at a content of at least about 3.0 wt.% and not greater than about 10.0 wt.% for a total weight of the filler composition, and a flame retardant component at least about 5.0 wt.% and not greater than about 20.0 wt.% for a total weight of the filler composition.
The subject application relates to a filler composition, composite material and composite material layer with thermal barrier properties. The present disclosure relates to a filler composition may include a ceramization filler component at a content of at least about 75 wt.% and not greater than about 95 wt.% for a total weight of the filler composition, a structure promoter component at a content of at least about 0.1 wt.% and not greater than about 7.0 wt.% for a total weight of the filler composition, a flux component at a content of at least about 0.1 wt.% and not greater than about 7.0 wt.% for a total weight of the filler composition, and a flame retardant component at least about 5.0 wt.% and not greater than about 20.0 wt.% for a total weight of the filler composition.
A liquid recovery filter assembly for recovering filtered liquid trapped within a core or downstream side of a filter element. Multiple embodiments each include a recovery port and a recovery filter in fluid communication with the core or downstream side of the filter element. The recovery port is opened following filtration operations to permit and to facilitate filtered liquid to flow from a downstream or outlet port, thus allowing recovery of liquid remaining in the filter core or downstream side following filtering operations. The recovery filter permits the introduction of pressurized gas to force the filtered liquids from the filter assembly without compromising the sterility and/or non-contaminant condition of the liquid. Additional aspects include exchangeable filter cartridges or filter elements in single and multi-round configurations, embodiments with aspiration tubes and dip tubes and still others with hydrophilic/hydrophobic recovery filters that function as filters and as valves for the recovery port.
B01D 29/21 - Éléments filtrants avec des supports agencés pour la filtration à courant dirigé vers l'intérieur à feuilles ondulées, pliées ou enroulées
B01D 29/52 - Filtres à éléments filtrants stationnaires pendant la filtration, p. ex. filtres à aspiration ou à pression, non couverts par les groupes Leurs éléments filtrants à plusieurs éléments filtrants caractérisés par leur agencement relatif montés en parallèle
B01D 29/58 - Filtres à éléments filtrants stationnaires pendant la filtration, p. ex. filtres à aspiration ou à pression, non couverts par les groupes Leurs éléments filtrants à plusieurs éléments filtrants caractérisés par leur agencement relatif montés en série disposés de façon concentrique ou coaxiale
B01D 29/90 - Filtres à éléments filtrants stationnaires pendant la filtration, p. ex. filtres à aspiration ou à pression, non couverts par les groupes Leurs éléments filtrants comportant des dispositifs d'alimentation ou d'évacuation d'alimentation
The disclosure relates to coated surfaces suitable for cell culture, to methods for making such surfaces, and to methods for culturing adherent cells on such surfaces. One aspect of the disclosure is a surface suitable for cell culture including an amorphous hydrogenated carbon coating. Another aspect of the disclosure is a method for making a surface suitable for cell culture including an amorphous hydrogenated carbon coating. Another aspect of the disclosure is a method for culturing adherent cells that includes incubating a surface including an amorphous hydrogenated carbon coating with adherent cells and a growth medium.
This disclosure relates generally to nucleic acid aptamers especially useful for cell transduction, as well as to containers (such as bags) having surfaces comprising one or such aptamers, and to transductions methods using such aptamers and containers. One embodiment of the disclosure provides A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).
This disclosure relates generally to nucleic acid aptamers especially useful for cell transduction, as well as to containers (such as bags) having surfaces comprising one or such aptamers, and to transductions methods using such aptamers and containers. One embodiment of the disclosure provides A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).
The disclosure relates to coated surfaces suitable for cell culture, to methods for making such surfaces, and to methods for culturing adherent cells on such surfaces. One aspect of the disclosure is a surface suitable for cell culture including an amorphous hydrogenated carbon coating. Another aspect of the disclosure is a method for making a surface suitable for cell culture including an amorphous hydrogenated carbon coating. Another aspect of the disclosure is a method for culturing adherent cells that includes incubating a surface including an amorphous hydrogenated carbon coating with adherent cells and a growth medium.
The present disclosure related to a silicone-based foam may include a component A and a component B, where the component A may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, and a third filler component that may include calcium carbonate, and where the component B may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, a third filler component that may include calcium carbonate, and a fourth filler component that may include zinc borate. The silicone-based foam may have a V-0 flammability rating as measured according to ASTM D3801.
The present disclosure related to a multilayer composite that may include a first polymethylpentene (TPX) liner, and a silicone-based foam layer overlying the first TPX liner. The silicone-based foam layer may include a component A and a component B, where the component A may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, and a third filler component that may include calcium carbonate, and where the component B may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, a third filler component that may include calcium carbonate, and a fourth filler component that may include zinc borate. The silicone-based foam layer may have a V-0 flammability rating as measured according to ASTM D3801.
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 5/18 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux
C08J 9/00 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement
C08J 9/14 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent physique de gonflage organique
The present disclosure related to a silicone-based foam may include a component A and a component B, where the component A may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, and a third filler component that may include calcium carbonate, and where the component B may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, a third filler component that may include calcium carbonate, and a fourth filler component that may include zinc borate. The silicone-based foam may have a V-0 flammability rating as measured according to ASTM D3801.
C08J 9/00 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement
C08G 77/08 - Procédés de préparation caractérisés par les catalyseurs utilisés
C08G 77/20 - Polysiloxanes contenant du silicium lié à des groupes aliphatiques non saturés
C08J 9/14 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent physique de gonflage organique
The present disclosure related to a multilayer composite that may include a first polymethylpentene (TPX) liner, and a silicone-based foam layer overlying the first TPX liner. The silicone-based foam layer may include a component A and a component B, where the component A may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, and a third filler component that may include calcium carbonate, and where the component B may include a silicone-based matrix component, a first filler component that may include alumina trihydrate, a second filler component that may include perlite, a third filler component that may include calcium carbonate, and a fourth filler component that may include zinc borate. The silicone-based foam layer may have a V-0 flammability rating as measured according to ASTM D3801.
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 5/20 - Produits stratifiés caractérisés par l'hétérogénéité ou la structure physique d'une des couches caractérisés par le fait qu'une des couches contient un matériau sous forme de mousse ou essentiellement poreux la structure sous forme de mousse étant réalisée sur place
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
C08G 77/08 - Procédés de préparation caractérisés par les catalyseurs utilisés
C08G 77/20 - Polysiloxanes contenant du silicium lié à des groupes aliphatiques non saturés
C08J 9/00 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement
C08J 9/14 - Mise en œuvre de substances macromoléculaires pour produire des matériaux ou objets poreux ou alvéolairesLeur post-traitement utilisant des gaz de gonflage produits par un agent de gonflage introduit au préalable par un agent physique de gonflage organique
A polyurethane foam may include a base polyol component, a phosphorous polyol component, an expandable graphite, and melamine. The polyurethane foam may have a VO rating based on a UL94 flame retardancy test performed at a polyurethane foam thickness of 3.5 mm and a polyurethane foam density of 380 kg/m3.
Embodiments described herein are generally directed to an annular seal including: an annular body defining a cross-section down a central axis, the annular body including: a first linear section oriented down a first plane; a first portion contiguous with the first end of the first linear section, the first portion being curved with respect to the first linear section and in accordance with a first predetermined radius, the first portion extending to a first distal end; a second portion contiguous with the second end of the first linear section, the second portion including: a second linear section oriented down a second plane non-parallel to the first plane; and at least one discrete, radially-oriented tab contiguous with the second linear section and oriented along a circumference of the annular body.
F16J 15/10 - Joints d'étanchéité entre surfaces immobiles entre elles avec garniture solide comprimée entre les surfaces à joindre par garniture non métallique
F16J 15/08 - Joints d'étanchéité entre surfaces immobiles entre elles avec garniture solide comprimée entre les surfaces à joindre exclusivement par garniture métallique
Embodiments described herein are generally directed to an annular seal including: an annular body defining a cross-section down a central axis, the annular body including: a first linear section oriented down a first plane; a first portion contiguous with the first end of the first linear section, the first portion being curved with respect to the first linear section and in accordance with a first predetermined radius, the first portion extending to a first distal end; a second portion contiguous with the second end of the first linear section, the second portion including: a second linear section oriented down a second plane non-parallel to the first plane; and at least one discrete, radially-oriented tab contiguous with the second linear section and oriented along a circumference of the annular body.
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
The present invention relates to a nut for a connector assembly for a tube including: an annular nut body including a polymer and oriented down a central axis, the annular nut body including: a circumferential split defining a first circumferential portion and a second circumferential portion, where the first circumferential portion and the second circumferential portion are flexibly connected by a pliable bridge portion, where the first circumferential portion includes a first circumferential end and the second circumferential portion includes a second circumferential end, where the first circumferential end and the second circumferential end each include a coupling component adapted to fix the first circumferential end and the second circumferential end together.
F16L 19/04 - Raccords dans lesquels les surfaces d'étanchéité sont maintenues en contact par un organe, p. ex. un écrou à oreilles vissé dans, ou vissé sur une des parties du raccord utilisant des segments rigides additionnels, scellés directement à une extrémité du tuyau au moins, cette extrémité étant rabattue soit avant, soit pendant l'opération d'assemblage
F16L 19/05 - Raccords dans lesquels les surfaces d'étanchéité sont maintenues en contact par un organe, p. ex. un écrou à oreilles vissé dans, ou vissé sur une des parties du raccord utilisant des segments rigides additionnels, scellés directement à une extrémité du tuyau au moins, cette extrémité étant rabattue soit avant, soit pendant l'opération d'assemblage avec un segment de poussée rigide disposé entre l'organe fileté et le côté extérieur évasé du tuyau
F16L 25/14 - Raccords pour tuyaux de diamètre ou de section transversale différents
F16L 47/04 - Raccordements ou autres accessoires de raccordement spécialement adaptés pour être en matières plastiques ou pour être utilisés avec des tuyaux en matières plastiques comprenant un écrou ou un collier rotatif s'engageant sur le tuyau
The present invention relates to a nut for a connector assembly for a tube including: an annular nut body including a polymer and oriented down a central axis, the annular nut body including: a circumferential split defining a first circumferential portion and a second circumferential portion, where the first circumferential portion and the second circumferential portion are flexibly connected by a pliable bridge portion, where the first circumferential portion includes a first circumferential end and the second circumferential portion includes a second circumferential end, where the first circumferential end and the second circumferential end each include a coupling component adapted to fix the first circumferential end and the second circumferential end together.
A tube includes a layer including a polymer matrix and a refractive index domain dispersed within the polymer matrix, wherein the refractive index domain has a refractive index less than a refractive index of the polymer matrix, the layer having a refractive index of less than 1.42.
A tube includes a layer including a polymer matrix and a refractive index domain dispersed within the polymer matrix, wherein the refractive index domain has a refractive index less than a refractive index of the polymer matrix, the layer having a refractive index of less than 1.42.
A composite film may include a first transparent substrate and a first anti-reflective coating overlying a first surface of the first transparent substrate. The first anti-reflective coating may include a first binder component and a first particulate filler component. The first particulate filler component may include hollow silica nanoparticles. The composite film may further have a VLT of at least about 94.0% and a water contact angle of at least about 70°.
C09D 5/00 - Compositions de revêtement, p. ex. peintures, vernis ou vernis-laques, caractérisées par leur nature physique ou par les effets produitsApprêts en pâte
C09D 7/61 - Adjuvants non macromoléculaires inorganiques
17 - Produits en caoutchouc ou en matières plastiques; matières à calfeutrer et à isoler
Produits et services
Fluid transfer system comprising a non-metal joint coupler that attaches two components that convey liquid together, a non-metal inbuilt type of connection that provides an internal full, double seal with its pre-formed rolled connection, and non-metal components equipped with housing body variations namely, fittings, valves, distribution bellows pumps, filters, filter housing, manifold, regulators, and flow meter for transporting fluids in microelectronic manufacturing facilities.
46.
FRICTION PAD, ASSEMBLY, AND METHOD OF MAKING AND USING THE SAME
A friction pad including a friction pad body including an annular base defining an aperture down a central axis, and first and second opposing major surfaces, where the friction pad body includes a low friction material, and where at least one of the major surfaces includes a plurality of grooves adapted to retain lubricant.
A friction pad including a friction pad body including an annular base defining an aperture down a central axis, and first and second opposing major surfaces, where the friction pad body includes a low friction material, and where at least one of the major surfaces includes a plurality of grooves adapted to retain lubricant.
F16D 7/02 - Accouplements à glissement, p. ex. glissant en cas de surcharge, pour absorber les chocs du type à friction
F16D 43/21 - Embrayages automatiques à commande interne actionnés entièrement mécaniquement commandés par le couple, p. ex. embrayages à déclenchement en cas de surcharge, embrayages à glissement avec dispositifs par lesquels le couple fait varier la pression d'embrayage avec organes à friction
F16D 69/00 - Garnitures de frictionLeur fixationEmploi pour travailler ensemble de matériaux ou de surfaces de friction spécifiées
Systems and methods include providing an annular seal stack for an assembly. The seal stack is disposed within an annulus formed between a probe and a housing of the assembly and configured to provide a radial seal between the probe and the housing. The seal stack includes a first support retainer, a first lipseal, a first seal support system comprising at least one support ring disposed between the first support retainer and the first lipseal, a second support retainer configured to support the first lipseal, a second lipseal, a second seal support system comprising at least one support ring disposed between the second support retainer and the second lipseal, and a third support retainer configured to support the second lipseal.
F16J 15/32 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques
F16J 15/3228 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre formée par déformation d’une bague plate
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
49.
ENERGIZING ELEMENT AND METHODS OF MAKING AND USING THE SAME
F16J 15/3208 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques
F16J 15/3288 - Structures filamentaires, p. ex. joints à brosse
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
50.
ENERGIZING ELEMENT AND METHODS OF MAKING AND USING THE SAME
An energizing element including: an energizing element body including an annular filament oriented about a central axis, the annular filament including a plurality of oscillations generally directed down the central axis, where at least one oscillation includes an internal circumferential void having a first circumferential width, WFV, and a second circumferential width, WSV, located at a different axial position along the oscillation, and where WFV≠WSV.
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
A seal including: an annular jacket including a body including a first lip, and a second lip defining an annular recess, the first lip including an arcuate exterior portion, the second lip including a rectilinear exterior portion and a rectilinear, tapered edge; and an annular energizer disposed within the annular recess, adjacent to at least one of the first lip and the second lip.
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
A seal including: an annular jacket including a body including a first lip, and a second lip defining an annular recess, the first lip including an arcuate exterior portion, the second lip including a rectilinear exterior portion and a rectilinear, tapered edge; and an annular energizer disposed within the annular recess, adjacent to at least one of the first lip and the second lip.
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
A seal can include a body including a thermoplastic material and a filler material including a fluoropolymer. The fluoropolymer can include a modified fluoropolymer. The body can include an elongation-at-break of at least 3%. In an embodiment, the seal can include a seal ring, wherein the body of the seal ring can include a weld.
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
F16J 15/3204 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre
54.
TORQUE PERFORMANCE BEARINGS AND METHODS OF MAKING AND USING THE SAME
A bearing including: a sidewall including a substrate and a low friction layer overlying the substrate, where the sidewall further includes: an unformed section; at least one slot in the unformed section; and at least one protrusion extending from the unformed section forming a generally concave or convex cross-sectional shape in the sidewall.
F16C 17/12 - Paliers à contact lisse pour mouvement de rotation exclusivement caractérisés par des particularités sans rapport avec la direction de la charge
F16C 33/30 - Éléments de roulements à billes ou à rouleaux
55.
TORQUE PERFORMANCE BEARINGS AND METHODS OF MAKING AND USING THE SAME
A bearing (400) including: a sidewall (402) including a substrate (1119) and a low friction layer (1104) overlying the substrate, where the sidewall further includes: an unformed section (440); at least one slot (442) in the unformed section; and at least one protrusion (450) extending from the unformed section forming a generally concave or convex cross-sectional shape in the sidewall.
A valve comprising: a valve body; and a valve stem disposed at least partially within the valve body, the valve stem comprising a sidewall defining a central lumen and at least one opening in the sidewall, wherein the valve is adapted to prevent fluid flow through the lumen when the at least one opening is disposed within the valve body and permit fluid flow through the lumen when the at least one opening is exposed from the valve body, and wherein the valve is essentially free of a spring.
F16K 5/04 - Robinets à boisseau consistant seulement en un dispositif obturateur dont au moins une des faces d'obturation a la forme d'une surface de solide de révolution plus ou moins complète, le mouvement d'ouverture et de fermeture étant essentiellement rotatif dont les boisseaux sont à surface cylindriqueLeurs garnitures d'étanchéité
A61M 39/16 - Raccords ou accouplements pour tubes avec des dispositions pour la désinfection ou la stérilisation
17 - Produits en caoutchouc ou en matières plastiques; matières à calfeutrer et à isoler
21 - Ustensiles, récipients, matériaux pour le ménage; verre; porcelaine; faience
Produits et services
Thermally conductive pressure sensitive adhesive tape for industrial and commercial use; phase change thermal pads for industrial and commercial use; Thermally conductive silicone rubber gap fillers for industrial and commercial use. Thermally conductive silicone coated glass fabrics for industrial and commercial use.
The subject application relates to polyurethane foam and methods of forming the same. A polyurethane foam may include a polyurethane foam may include a first polyol component, a second polyol component, and a third polyol component. The first polyol component may include at least one component selected from the group of a polyether polyol and a polyester polyol. The second polyol component may include a polyether polyol. The third polyol component may include a grafted polyether polyol. The polyurethane foam may have a density of at least about 100 kg/m3 and not greater than about 800 kg/m3. The polyurethane foam may have an adjusted compression force deflection to density ratio of at least about 0.3.
A seal including a jacket including an annular body defining a central axis and a recess extending into the annular body concentric to the central axis, where the jacket includes at least 30 wt % of a PTFE and at least 10 wt % of a filler material, and where the filler material includes a boron-containing material, a nitrogen-containing material, a titanium-containing material, a silicon-containing material, a carbon fiber, a glass fiber, or a combination thereof; and an energizing element disposed in the recess, where the energizing element includes a gap-less spring.
F16J 15/34 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par bague glissante pressée contre la face plus ou moins radiale d'une des deux parties
The subject application relates to polyurethane foam and methods of forming the same. A polyurethane foam may include a polyurethane foam may include a first polyol component, a second polyol component, and a third polyol component. The first polyol component may include at least one component selected from the group of a polyether polyol and a polyester polyol. The second polyol component may include a polyether polyol. The third polyol component may include a grafted polyether polyol. The polyurethane foam may have a density of at least about 100 kg/m3and not greater than about 800 kg/m3. The polyurethane foam may have an adjusted compression force deflection to density ratio of at least about 0.3.
A seal including a jacket including an annular body defining a central axis and a recess extending into the annular body concentric to the central axis, where the jacket includes at least 30 wt% of a PTFE and at least 10 wt% of a filler material, and where the filler material includes a boron-containing material, a nitrogen-containing material, a titanium-containing material, a silicon-containing material, a carbon fiber, a glass fiber, or a combination thereof; and an energizing element disposed in the recess, where the energizing element includes a gap-less spring.
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
B32B 27/36 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyesters
B32B 7/12 - Liaison entre couches utilisant des adhésifs interposés ou des matériaux interposés ayant des propriétés adhésives
B32B 7/06 - Liaison entre couches permettant une séparation sans difficultés
B32B 37/26 - Procédés ou dispositifs pour la stratification, p. ex. par polymérisation ou par liaison à l'aide d'ultrasons caractérisés par les propriétés des couches avec au moins une couche influençant la liaison au cours de la stratification, p. ex. couches anti-adhésives ou couches égalisatrices de la pression
64.
MULTILAYER LAMINATE STRUCTURE AND METHOD OF FORMING THE SAME
The present disclosure relates to a multilayer laminate structure may include a glass substrate having a thickness of not greater than about 300 microns, a fluoropolymer based layer, and an adhesive layer in contact with the fluoropolymer based layer and between the glass substrate and the fluoropolymer based layer. The adhesive layer comprises an adhesive component and a first adhesive layer ultra violet (UV) absorber component. The multilayer laminate structure may have a lower ultra-violet light transmission (L-UVLT) of not greater than 1.0%, a high ultra-violet light transmission (H-UVLT) of not greater than 5.0%, and a visual light transmission (VLT) of at least about 50.0%.
B32B 17/10 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire comprenant du verre comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
B32B 7/12 - Liaison entre couches utilisant des adhésifs interposés ou des matériaux interposés ayant des propriétés adhésives
The present disclosure relates to a multilayer film may include a fluoropolymer based layer that may include a fluoropolymer based material, and an adhesive layer in contact with the fluoropolymer based layer. The adhesive layer may include a first ultra-violet (UV) absorber component. The multilayer film may have a lower ultra-violet light transmission (L-UVLT) of not greater than 1.0%, where the L-UVLT of the multilayer film is defined as the percent transmission between 200 nm and 360 nm. The multilayer film may further have a high ultra-violet light transmission (H-UVLT) of not greater than 5.0%, where the H-UVLT of the multilayer film is defined as the percent transmission between 360 nm and 380 nm. The multilayer film may include a visual light transmission (VLT) of at least about 50.0%, where the VLT of the multilayer film is defined as the percent transmission between 400 nm and 1100 nm.
C09J 7/24 - Matières plastiquesMatières plastiques métallisées à base de composés macromoléculaires obtenus par des réactions faisant intervenir uniquement des liaisons non saturées carbone-carbone
C09J 7/30 - Adhésifs sous forme de films ou de pellicules caractérisés par la composition de l’adhésif
66.
MULTILAYER LAMINATE STRUCTURE AND METHOD OF FORMING THE SAME
The present disclosure relates to a multilayer laminate structure may include a glass substrate having a thickness of not greater than about 300 microns, a fluoropolymer based layer, and an adhesive layer in contact with the fluoropolymer based layer and between the glass substrate and the fluoropolymer based layer. The fluoropolymer based layer may include a fluoropolymer based material and a first fluoropolymer based layer ultra-violet (UV) component. The multilayer laminate structure may have a lower ultra-violet light transmission (L-UVLT) of not greater than 1.0%, a high ultra-violet light transmission (H-UVLT) of not greater than 5.0%, and a visual light transmission (VLT) of at least about 50.0%.
B32B 17/10 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire comprenant du verre comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
A bearing including a sidewall including an electrically conductive substrate, and an electrically non-conductive or low-conductive sliding layer coupled to the substrate, where the sidewall includes at least one circumferential rib feature protruding radially inward or radially outward from a bore defining a central axis, where the at least one circumferential rib feature has an aspect ratio between a circumferential length and an axial width of at least 2:1, where the circumferential rib feature is adapted to contact an opposing component such that at a point of contact the bearing has a void area free of sliding layer so as to provide electrical conductivity between the bearing and the opposing component.
The present disclosure relates to a multilayer protective film that may include a multilayer component and a release liner component underlying the multilayer component. The multilayer component may have a first PET layer overlying a second PET layer. The multilayer protective film may further have a thickness ratio MPFT:RLT of not greater than about 14:1, where MPFT is equal to the thickness of the multilayer component and RLT is equal to the thickness of the release liner component.
C09J 7/25 - Matières plastiquesMatières plastiques métallisées à base de composés macromoléculaires obtenus par des réactions autres que celles faisant intervenir uniquement des liaisons non saturées carbone-carbone
C09J 7/40 - Adhésifs sous forme de films ou de pellicules caractérisés par des couches antiadhésives
C09J 133/08 - Homopolymères ou copolymères d'esters de l'acide acrylique
The present disclosure relates to a multilayer laminate structure may include a glass substrate having a thickness of not greater than about 300 microns, a fluoropolymer based layer, and an adhesive layer in contact with the fluoropolymer based layer and between the glass substrate and the fluoropolymer based layer. The fluoropolymer based layer may include a fluoropolymer based material and a first fluoropolymer based layer ultraviolet (UV) component. The multilayer laminate structure may have a lower ultraviolet light transmission (L-UVLT) of not greater than 1.0%, a high ultraviolet light transmission (H-UVLT) of not greater than 5.0%, and a visual light transmission (VLT) of at least about 50.0%.
B32B 17/10 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire comprenant du verre comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
B32B 7/12 - Liaison entre couches utilisant des adhésifs interposés ou des matériaux interposés ayant des propriétés adhésives
B32B 27/18 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers
B32B 37/12 - Procédés ou dispositifs pour la stratification, p. ex. par polymérisation ou par liaison à l'aide d'ultrasons caractérisés par l'usage d'adhésifs
B32B 27/36 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyesters
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
70.
ELECTRICALLY CONDUCTIVE BEARING WITH RIB AND METHOD OF MAKING AND USING THE SAME
A bearing including a sidewall including an electrically conductive substrate, and an electrically non-conductive or low-conductive sliding layer coupled to the substrate, where the sidewall includes at least one circumferential rib feature protruding radially inward or radially outward from a bore defining a central axis, where the at least one circumferential rib feature has an aspect ratio between a circumferential length and an axial width of at least 2:1, where the circumferential rib feature is adapted to contact an opposing component such that at a point of contact the bearing has a void area free of sliding layer so as to provide electrical conductivity between the bearing and the opposing component.
The present disclosure relates to a pressure sensitive adhesive may include a silicone based pressure sensitive adhesive component, and an iron oxide filler mixture. The content of the iron oxide filler mixture may be at least about 0.5 wt. % and not greater than about 10.0 wt. % for a total weight of the pressure sensitive adhesive. The pressure sensitive adhesive may have a peel adhesion of at least about 600 g/in when measured at 25° C., and the pressure sensitive adhesive may further have a UL 94 rating of VTM-0, a UL 94 rating of V-0, or a UL 94 rating of both VTM-0 and V-0 when attached to a backing material.
The present disclosure relates to a multilayer laminate structure may include a glass substrate having a thickness of not greater than about 300 microns, a fluoropolymer based layer, and an adhesive layer in contact with the fluoropolymer based layer and between the glass substrate and the fluoropolymer based layer. The adhesive layer comprises an adhesive component and a first adhesive layer ultraviolet (UV) absorber component. The multilayer laminate structure may have a lower ultraviolet light transmission (L-UVLT) of not greater than 1.0%, a high ultraviolet light transmission (H-UVLT) of not greater than 5.0%, and a visual light transmission (VLT) of at least about 50.0%.
C09J 11/06 - Additifs non macromoléculaires organiques
B32B 7/12 - Liaison entre couches utilisant des adhésifs interposés ou des matériaux interposés ayant des propriétés adhésives
B32B 17/10 - Produits stratifiés composés essentiellement d'une feuille de verre ou de fibres de verre, de scorie ou d'une substance similaire comprenant du verre comme seul composant ou comme composant principal d'une couche adjacente à une autre couche d'une substance spécifique de résine synthétique
B32B 27/32 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyoléfines
The present disclosure relates to a multilayer film may include a fluoropolymer based layer that may include a fluoropolymer based material, and an adhesive layer in contact with the fluoropolymer based layer. The adhesive layer may include a first ultra-violet (UV) absorber component. The multilayer film may have a lower ultra-violet light transmission (L-UVLT) of not greater than 1.0%, where the L-UVLT of the multilayer film is defined as the percent transmission between 200 nm and 360 nm. The multilayer film may further have a high ultra-violet light transmission (H-UVLT) of not greater than 5.0%, where the H-UVLT of the multilayer film is defined as the percent transmission between 360 nm and 380 nm. The multilayer film may include a visual light transmission (VLT) of at least about 50.0%, where the VLT of the multilayer film is defined as the percent transmission between 400 nm and 1100 nm.
The present disclosure relates a multilayered film may include a first PET substrate, and a first anti-fog/anti-microbial (AFAM) coating overlying the first PET substrate. The first AFAM coating may include an acrylate-based component, a silver-based filler component within the acrylate-based component, and a photo initiator component. The first AFAM coating may have a water contact angle of not greater than about 55˚. The first AFAM coating may have a MRSA anti-microbial rating of at least about 75%, where the MRSA anti-microbial rating is defined as the percent reduction of methicillin-resistant Staphylococcus aureus (MRSA) activity from an initial inoculation of MRSA on the surface of the anti-microbial layer after 24 hours as measured using ISO22196.
C08J 7/054 - Formation de revêtements anti-buée ou anti-gouttes
C09D 4/00 - Compositions de revêtement, p. ex. peintures, vernis ou vernis-laques, à base de composés non macromoléculaires organiques ayant au moins une liaison non saturée carbone-carbone polymérisable
C09D 5/14 - Peintures contenant des biocides, p. ex. fongicides, insecticides ou pesticides
B32B 27/20 - Produits stratifiés composés essentiellement de résine synthétique caractérisée par l'emploi d'additifs particuliers utilisant des charges, des pigments, des agents thixotropiques
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
The present disclosure relates to a pressure sensitive adhesive may include a silicone based pressure sensitive adhesive component, and an iron oxide filler mixture. The content of the iron oxide filler mixture may be at least about 0.5 wt.% and not greater than about 10.0 wt.% for a total weight of the pressure sensitive adhesive. The pressure sensitive adhesive may have a peel adhesion of at least about 600 g/in when measured at 25 ˚C, and the pressure sensitive adhesive may further have a UL 94 rating of VTM-0, a UL 94 rating of V-0, or a UL 94 rating of both VTM-0 and V-0when attached to a backing material.
A polymer composition including a fluoropolymer composition including greater than 99 wt % polytetrafluoroethylene, where the fluoropolymer composition exhibits a melting temperature of greater than 327° C. at a pressure of 0.1 MPa.
The present disclosure relates a multilayered film may include a first PET substrate, and a first anti-fog/anti-microbial (AFAM) coating overlying the first PET substrate. The first AFAM coating may include an acrylate-based component, a silver-based filler component within the acrylate-based component, and a photo initiator component. The first AFAM coating may have a water contact angle of not greater than about 55° . The first AFAM coating may have a MRSA anti-microbial rating of at least about 75%, where the MRSA anti-microbial rating is defined as the percent reduction of methicillin-resistant Staphylococcus aureus (MRSA) activity from an initial inoculation of MRSA on the surface of the anti-microbial layer after 24 hours as measured using ISO22196.
A polymer composition including a fluoropolymer composition including greater than 99 wt% polytetrafluoroethylene, where the fluoropolymer composition exhibits a melting temperature of greater than 327˚C at a pressure of 0.1 MPa.
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
An article including at least one polymer, the at least one polymer including a silicone elastomer, wherein the article has an outer surface treated to provide at least silicon moieties, silicon-oxide moieties, silica-like moieties, organosilicon moieties, hydroxyl moieties, hydrocarbon moieties, or combination thereof, wherein the outer surface has a tack decrease of at least 75% compared to a non-treated outer surface.
An article including at least one polymer, the at least one polymer including a silicone elastomer, a thermoplastic elastomer, or combination thereof, wherein the article has an outer surface treated to provide at least silicon moieties, silicon-oxide moieties, silica-like moieties, organosilicon moieties, hydroxyl moieties, hydrocarbon moieties, or combination thereof, wherein the outer surface has a tack decrease of at least 50% compared to a non-treated outer surface.
B of at least about 0.01 and not greater than about 1.3. The composite film may further have a VLT of at least about 93.0% and a haze value of not greater than about 3%.
B32B 27/36 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyesters
B32B 7/12 - Liaison entre couches utilisant des adhésifs interposés ou des matériaux interposés ayant des propriétés adhésives
C09D 4/00 - Compositions de revêtement, p. ex. peintures, vernis ou vernis-laques, à base de composés non macromoléculaires organiques ayant au moins une liaison non saturée carbone-carbone polymérisable
B32B 27/08 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique d'une résine synthétique d'une sorte différente
C08K 9/06 - Ingrédients traités par des substances organiques par des composés contenant du silicium
C08K 9/04 - Ingrédients traités par des substances organiques
C09D 5/00 - Compositions de revêtement, p. ex. peintures, vernis ou vernis-laques, caractérisées par leur nature physique ou par les effets produitsApprêts en pâte
C09D 135/02 - Homopolymères ou copolymères d'esters
The present disclosure relates to a dielectric substrate that may include a polyimide layer and a first filled polymer layer overlying the polyimide layer. The first filled polymer layer may include a resin matrix component, and a first ceramic filler component. The first ceramic filler component may include a first filler material. The first filler material may further have a mean particle size of at not greater than about 10 microns.
A seal including: an annular jacket including a heel, a first lip, and a second lip defining an annular recess; and an insert including at least 3 prongs disposed within the annular recess contacting the heel, the first lip, and the second lip.
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
86.
SEAL WITH COATING AND METHOD OF MAKING AND USING THE SAME
A seal including a jacket including an annular body defining a central axis and a recess extending into the annular body concentric to the central axis, where the jacket includes at least 30 wt% of a PTFE and at least 10 wt% of a filler material, and where the filler material includes a boron-containing material, a nitrogen-containing material, a titanium-containing material, a silicon-containing material, a carbon fiber, a glass fiber, or a combination thereof, where the jacket further includes a coating; and an energizing element disposed in the recess.
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
A multilayer tube includes: an inner layer including a polymer, wherein the polymer includes a fluoropolymer, a polyolefin, a blend thereof, or combination thereof; and an outer layer adjacent to the inner layer, wherein the outer layer includes a polymer including a fluoropolymer, a polyolefin, a blend thereof, or combination thereof; wherein the inner layer, the outer layer, or combination thereof includes at least one blocking agent, wherein the at least one blocking agent reduces the percent transmission by at least 99% at wavelengths between 240 nm to 450 nm.
F16L 11/12 - Manches, c.-à-d. tuyaux flexibles en caoutchouc ou en matériaux plastiques flexibles avec agencements pour usages particuliers, p. ex. spécialement profilés, avec couche protectrice, chauffés, conducteurs d'électricité
F16L 11/04 - Manches, c.-à-d. tuyaux flexibles en caoutchouc ou en matériaux plastiques flexibles
88.
Seal with insert and methods of making and using the same
A seal including: an annular jacket including a heel, a first lip, and a second lip defining an annular recess; and an insert including at least 3 prongs disposed within the annular recess contacting the heel, the first lip, and the second lip.
F16J 15/32 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
89.
SLIDING MATERIAL, BEARING, AND METHODS OF MAKING AND USING THE SAME
A sliding material including: a substrate, and a textured sliding layer overlying the substrate, where the sliding layer includes asperities including a plurality of apexes and nadirs, where 1) the sliding layer has a root mean square gradient of less than 0.064; 2) the sliding layer has an apex material portion of less than 10%; 3) the sliding layer has a nadir material portion of less than 75%, and where the textured sliding layer induces formation of a film when engaged in a rotational interface w/ another component.
A seal including a jacket including an annular body defining a central axis and a recess extending into the annular body concentric to the central axis, where the jacket includes at least 30 wt% of a PTFE and at least 10 wt% of a filler material, and where the filler material includes a boron-containing material, a nitrogen-containing material, a titanium-containing material, a silicon-containing material, a carbon fiber, a glass fiber, or a combination thereof, where the jacket further includes a coating; and an energizing element disposed in the recess.
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3284 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques caractérisés par leur structureEmploi des matériaux
91.
SLIDING MATERIAL, BEARING, AND METHODS OF MAKING AND USING THE SAME
A sliding material including: a substrate, and a textured sliding layer overlying the substrate, where the sliding layer includes asperities including a plurality of apexes and nadirs, where 1) the sliding layer has a root mean square gradient of less than 0.064; 2) the sliding layer has an apex material portion of less than 10%; 3) the sliding layer has a nadir material portion of less than 75%, and where the textured sliding layer induces formation of a film when engaged in a rotational interface w/ another component.
The present disclosure relates to a multilayer composite that may include a first porous layer, and a first barrier layer overlying the first porous layer. The first barrier layer may include a polyaramid material, a polyimide material, or any combination thereof. The multilayer composite may have a flame resistance rating of at least about 180° C. and a 50% strain compression rating of not greater than about 600 kPa.
B32B 27/34 - Produits stratifiés composés essentiellement de résine synthétique comprenant des polyamides
B32B 27/06 - Produits stratifiés composés essentiellement de résine synthétique comme seul composant ou composant principal d'une couche adjacente à une autre couche d'une substance spécifique
B32B 27/28 - Produits stratifiés composés essentiellement de résine synthétique comprenant des copolymères de résines synthétiques non complètement couverts par les sous-groupes suivants
H01M 50/229 - Matériau composite constitué d'un mélange de matériaux organiques et inorganiques
H01M 50/231 - MonturesBoîtiers secondaires ou cadresBâtis, modules ou blocsDispositifs de suspensionAmortisseursDispositifs de transport ou de manutentionSupports caractérisés par le matériau des boîtiers ou des bâtis ayant une structure en couches
A seal including: an annular jacket including a body including a first lip and a second lip defining an annular recess; an axially oriented spring disposed within the annular recess adjacent to one of the first lip and the second lip; where a radial biasing force on the first lip is decoupled from a radial biasing force on the second lip.
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
A seal including: an annular jacket including a body including a first lip and a second lip defining an annular recess; a circumferential spring disposed within the annular recess adjacent to one of the first lip and the second lip; and a floating circumferential insert, where a radial biasing force on the first lip is decoupled from a radial biasing force on the second lip.
F16J 15/32 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques
F16J 15/3208 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
A seal including: an annular jacket including a body including a first lip and a second lip defining an annular recess; an axially oriented spring disposed within the annular recess adjacent to one of the first lip and the second lip; where a radial biasing force on the first lip is decoupled from a radial biasing force on the second lip.
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
A seal including: an annular jacket including a body including a first lip and a second lip defining an annular recess; a circumferential spring disposed within the annular recess adjacent to one of the first lip and the second lip; and a floating circumferential insert, where a radial biasing force on the first lip is decoupled from a radial biasing force on the second lip.
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
F16J 15/3236 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres dont au moins une lèvre pour chaque surface, p. ex. conditionnements en U
F16J 15/3232 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre ayant plusieurs lèvres
F16J 15/3212 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre pourvue d’éléments de tension, p. ex. de bagues élastiques avec des ressorts métalliques
Systems and methods are disclosed that include providing a filter assembly having a filter body with an inlet and an outlet, a filter membrane support disposed within the filter body between the inlet and outlet, a filter membrane coupled to the filter membrane support, and at least one component that passes through the inlet, the filter membrane support, and the outlet to carry an electrical current, a fluid, or combinations thereof through the filter.
F16J 15/3204 - Joints d'étanchéité entre deux surfaces mobiles l'une par rapport à l'autre par joints élastiques, p. ex. joints toriques avec au moins une lèvre
100.
MAGNETIC MULTILAYER COMPOSITE AND A METHOD OF FORMING THE SAME
The present disclosure relates to a magnetic multilayer composite that may include a core substrate layer, an outer magnetic layer overlying a first surface of the core substrate layer, and an inner magnetic layer underlying a second surface of the core substrate layer. The composite may include a magnetic volume ratio VM/VS of at least about 0.005, where VM is equal to the total volume of magnetic material in the composite and VS is the total volume of substrate. The composite may further include a permeability rating (X, Y), where the permeability rating (X, Y) is equal to a peak point (X, Y) along a plot of the imaginary part of magnetic permeability (μ″) of the composite plotted as a function of frequency, where X is within the range of 10 MHz to 10 GHz, and Y is greater than 100.
