Abrégé

This ligand conjugate nucleic acid represented by general formula (I) [In the formula (I), the symbols are as defined in the specification.] provides a therapeutic and/or prophylactic agent which enables serum stability, delivery to an appropriate organ or cell, and transmembrane delivery, and which can impart high functionality at low production cost.

Classes IPC  ?

• C07H 21/04 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques avec le désoxyribosyle comme radical saccharide
• A61K 31/711 - Acides désoxyribonucléiques naturels, c.-à-d. contenant uniquement des 2'-désoxyriboses liés à l'adénine, la guanine, la cytosine ou la thymine et ayant des liaisons 3'-5' phosphodiester
• A61K 31/713 - Acides nucléiques ou oligonucléotides à structure en double-hélice
• A61K 47/54 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p. ex. conjugués polymère-médicament l’ingrédient non actif étant un agent de modification l’agent de modification étant un composé organique
• C12N 15/87 - Introduction de matériel génétique étranger utilisant des procédés non prévus ailleurs, p. ex. co-transformation
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens

Abrégé

The present invention addresses the problem of providing a new nucleic acid molecule which is for inhibiting the expression of a target gene, and which (1) has gene expression inhibition activity equal to or greater than siRNA, (2) has no off-target effects due to a sense strand, and (3) makes possible a broader antisense strand sequence design (expansion of targetable sequence range). In the formula, the definition of each symbol is as written in the description. The nucleic acid molecule shown has excellent characteristics with respect to the aforementioned (1) – (3) and so is extremely useful as a novel gene expression inhibitor instead of conventional siRNA.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/712 - Acides nucléiques ou oligonucléotides ayant des sucres modifiés, c.-à-d. autres que le ribose ou le 2'-désoxyribose
• A61K 31/7125 - Acides nucléiques ou oligonucléotides ayant des liaisons internucléosides modifiées, c.-à-d. autres que des liaisons 3'-5' phosphodiester
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 11/00 - Médicaments pour le traitement des troubles du système respiratoire
• A61P 35/00 - Agents anticancéreux

Abrégé

The present invention provides a nucleic acid molecule containing, as a SARS-CoV-2 gene expression-inhibiting sequence, a nucleotide sequence that is complementary to a nucleotide sequence comprising 15 or more consecutive nucleotides in a target genomic RNA sequence, said target genomic RNA sequence comprising 25 or less consecutive nucleotides containing a nucleotide sequence represented by the following nucleotide numbers in the nucleotide sequence of SARS-CoV-2 genomic RNA represented by SEQ ID NO: 1: (1) 545-563; (2) 589-607; (3) 664-682; (4) 6503-6521; (5) 6504-6522; (6) 7693-7711; (7) 8618-8636; (8) 12943-12961; (9) 13004-13022; (10) 13945-13963; (11) 15243-15261; (12) 17648-17666; (13) 17766-17784; (14) 21401-21419; (15)23318-23336; (16) 23763-23781; (17) 23948-23966; (18) 24116-24134; (19) 25481-25499; (20) 25839-25857; (21) 26261-26279; (22) 26276-26294; (23) 26284-26302; (24) 26316-26334; (25) 26338-26356; (26) 26352-26370; (27) 26525-26543; (28) 26586-26604; (29) 26753-26771; (30) 27102-27120; (31) 27589-27607; (32) 27600-27618; (33) 28102-28120; (34) 28367-28385; (35) 28400-28418; (36) 28774-28792; (37) 28830-28848; (38) 29002-29020; (39) 29044-29062; (40) 29167-29185; (41) 29579-29597; (42) 29613-29631; (43) 28-46 or (44) 40-58, or a nucleotide sequence that is complementary to a nucleotide sequence comprising 15 or more consecutive nucleotides in a target negative strand RNA sequence, said target negative strand RNA sequence comprising 25 or less consecutive nucleotides containing a negative strand RNA nucleotide sequence corresponding to nucleotide numbers (45) 333-351 or (46) 8349-8367.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7088 - Composés ayant au moins trois nucléosides ou nucléotides
• A61K 31/713 - Acides nucléiques ou oligonucléotides à structure en double-hélice
• A61K 35/76 - VirusParticules sous-viralesBactériophages
• A61K 47/54 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p. ex. conjugués polymère-médicament l’ingrédient non actif étant un agent de modification l’agent de modification étant un composé organique
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 31/12 - Antiviraux
• A61P 31/14 - Antiviraux pour le traitement des virus ARN
• C07K 14/165 - Coronaviridae, p. ex. virus de la bronchite infectieuse aviaire
• C12N 15/50 - Coronaviridae, p. ex. virus de la bronchite infectieuse, virus de la gastro-entérite transmissible
• C12N 15/63 - Introduction de matériel génétique étranger utilisant des vecteursVecteurs Utilisation d'hôtes pour ceux-ciRégulation de l'expression
• C12N 15/85 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes eucaryotes pour cellules animales

Produits et services

Chemicals; industrial chemicals; nucleic acid reagents, other than for medical purposes; nucleic acid sequences, other than for medical or veterinary purposes; nucleic acids for scientific purposes; reagents for scientific purposes for use in nucleic acid isolation and purification. Nucleic acid medicines; nucleic acid drugs; reagents for detecting nucleic acid; diagnostic kits comprising reagents for detecting nucleic acid; diagnostic reagents for separating ribonucleic acid in the field of clinical test relating to medical treatment; reagents for detecting, identifying, analyzing and quantifying nucleic acid for pharmaceutical or diagnostic purposes; reagents for detecting nucleic acid mutation for medical purposes. Custom manufacturing of nucleic acids; custom manufacturing of chemical substances. Development of pharmaceutical preparations and medicines; research in the field of pharmaceuticals; testing, inspection and research services in the fields of pharmaceuticals, cosmetics and foodstuffs; consultancy in the field of pharmaceutical research; providing information about medical research in the field of pharmaceuticals.

Produits et services

Chemicals; industrial chemicals; nucleic acid reagents, other than for medical purposes; nucleic acid sequences, other than for medical or veterinary purposes; nucleic acids for scientific purposes; reagents for scientific purposes for use in nucleic acid isolation and purification. Pharmaceutical preparations; nucleic acid sequences for medical and veterinary purposes; nucleic acid medicines; pharmaceutical drugs. Custom manufacturing of nucleic acids; custom manufacturing of chemical substances; custom manufacture of pharmaceuticals. Development of pharmaceutical preparations and medicines; research in the field of pharmaceuticals; testing, inspection and research services in the fields of pharmaceuticals, cosmetics and foodstuffs; consultancy in the field of pharmaceutical research; providing information about medical research in the field of pharmaceuticals.

Produits et services

Chemicals; industrial chemicals; nucleic acid reagents, other than for medical purposes; nucleic acid sequences, other than for medical or veterinary purposes; nucleic acids for scientific purposes; reagents for scientific purposes for use in nucleic acid isolation and purification. Pharmaceutical preparations; nucleic acid sequences for medical and veterinary purposes; nucleic acid medicines; pharmaceutical drugs. Custom manufacturing of nucleic acids; custom manufacturing of chemical substances. Development of pharmaceutical preparations and medicines; research in the field of pharmaceuticals; testing, inspection and research services in the fields of pharmaceuticals, cosmetics and foodstuffs; consultancy in the field of pharmaceutical research; providing information about medical research in the field of pharmaceuticals.

Produits et services

Chemicals; industrial chemicals; nucleic acid reagents, other than for medical purposes; nucleic acid sequences, other than for medical or veterinary purposes; nucleic acids for scientific purposes; reagents for scientific purposes for use in nucleic acid isolation and purification. Pharmaceutical preparations; nucleic acid sequences for medical and veterinary purposes; nucleic acid medicines; pharmaceutical drugs. Custom manufacturing of nucleic acids; custom manufacturing of chemical substances; custom manufacture of pharmaceuticals. Development of pharmaceutical preparations and medicines; research in the field of pharmaceuticals; testing, inspection and research services in the fields of pharmaceuticals, cosmetics and foodstuffs; consultancy in the field of pharmaceutical research; providing information about medical research in the field of pharmaceuticals.

Produits et services

Chemicals; industrial chemicals; nucleic acid reagents, other than for medical purposes. Pharmaceutical preparations; nucleic acid medicine; pharmaceutical drugs. Custom manufacturing of nucleic acids; custom manufacturing of chemical substances. Development of pharmaceutical preparations and medicines; research in the field of pharmaceuticals; testing, inspection and research services in the fields of pharmaceuticals, cosmetics and foodstuffs; consultancy in the field of pharmaceutical research; providing information about medical research in the field of pharmaceuticals.

Abrégé

The present invention provides a single-stranded nucleic acid molecule that has TGF-β1 expression suppressing activity. The single-stranded nucleic acid molecule comprises the nucleotide sequence represented by SEQ ID NO:1 (in which P is a proline derivative linker represented by formula (I)), it being possible for the nucleotide sequences of the underlined portion and the double-underlined portion to form Watson-Crick base pairs (but there being no base to pair with the U at the 49th position), wherein 1–4 base pairs are deleted and/or 1–3 base pairs are substituted by other base pairs (including the U at the 49th position being substituted by another base).

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7088 - Composés ayant au moins trois nucléosides ou nucléotides
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 11/00 - Médicaments pour le traitement des troubles du système respiratoire

Abrégé

The present invention addresses the problem of providing a pharmaceutical composition that combines artificial siRNA capable of suppressing hepatitis B virus gene expression and a lipid that is exceptional in terms of nucleic acid delivery, and a treatment agent. The present invention provides a pharmaceutical composition that includes artificial siRNA capable of suppressing hepatitis B virus gene expression, a lipid that is a compound represented by formula (1) or a salt thereof, cholesterol, and a lipid having a polyethylene glycol structure, wherein the artificial siRNA includes a nucleic acid molecule composed of a base sequence represented by sequence A below. (Sequence A) 5'-CGUCUGUGCCUUCUCAUCUUCAU-P-AUGAAGAUGAGAAGGCACAGACGGG-3' In the formula, P represents a prescribed linker. In the formula, X, R2-R12, a, b, c, and d have the meanings defined in the specification.

Classes IPC  ?

• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61K 47/18 - AminesAmidesUréesComposés d’ammonium quaternaireAcides aminésOligopeptides ayant jusqu’à cinq acides aminés
• A61K 47/24 - Composés organiques, p. ex. hydrocarbures naturels ou synthétiques, polyoléfines, huile minérale, gelée de pétrole ou ozocérite contenant des atomes autres que des atomes de carbone, d'hydrogène, d'oxygène, d'halogènes, d'azote ou de soufre, p. ex. cyclométhicone ou phospholipides
• A61K 47/28 - Stéroïdes, p. ex. cholestérol, acides biliaires ou acide glycyrrhétinique
• A61K 47/34 - Composés macromoléculaires obtenus par des réactions autres que celles faisant intervenir uniquement des liaisons non saturées carbone-carbone, p. ex. polyesters, acides polyaminés, polysiloxanes, polyphosphazines, copolymères de polyalkylène glycol ou de poloxamères
• A61P 1/16 - Médicaments pour le traitement des troubles du tractus alimentaire ou de l'appareil digestif des troubles de la vésicule biliaire ou du foie, p. ex. protecteurs hépatiques, cholagogues, cholélitholytiques
• A61P 31/20 - Antiviraux pour le traitement des virus ADN
• A61P 43/00 - Médicaments pour des utilisations spécifiques, non prévus dans les groupes
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens

Abrégé

The present invention provides a nucleic acid molecule which can suppress the amplification of hepatitis B virus DNA significantly. More specifically, the present invention provides a single-stranded nucleic acid molecule which can suppresses the amplification of hepatitis B gene virus DNA, the nucleic acid molecule being characterized by being composed only of a region (X), a linker region (Lx) and a region (Xc), the linker region (Lx) having a non-nucleotide structure containing at least one of a pyrrolidine base structure and a piperidine base structure, and at least one of the region (X) and the region (Xc) comprising a nucleotide sequence composed of at least 18 contiguous bases contained in any one of sequences capable of suppressing the expression of hepatitis B virus gene represented by SEQ ID NOs:1 and 2, human NCAPH gene represented by SEQ ID NOs:3 to 5, human Sp1 gene represented by SEQ ID NOs:6 and 7 and human SOCS7 gene represented by SEQ ID NOs:8 and 9.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7125 - Acides nucléiques ou oligonucléotides ayant des liaisons internucléosides modifiées, c.-à-d. autres que des liaisons 3'-5' phosphodiester
• A61K 31/713 - Acides nucléiques ou oligonucléotides à structure en double-hélice
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 1/16 - Médicaments pour le traitement des troubles du tractus alimentaire ou de l'appareil digestif des troubles de la vésicule biliaire ou du foie, p. ex. protecteurs hépatiques, cholagogues, cholélitholytiques
• A61P 31/20 - Antiviraux pour le traitement des virus ADN
• A61P 35/00 - Agents anticancéreux

Abrégé

The present invention is a method for producing hairpin single-strand RNA molecules that suppresses expression of a target gene. This method includes a step in which a first single-strand oligo RNA molecules represented by formula (I) and a second single-strand oligo RNA molecules represented by formula (II) are reacted in a mixed solvent including a buffer and a hydrophilic organic solvent, in the presence of a dehydration condensation agent. Formula (I): 5'-Xc-Lx1Formula (II): Lx2-X-Y-Ly-Yc-3' The dehydration condensation agent is selected from the group consisting of a triazine-type dehydration condensation agent, a uronium-type dehydration condensation agent including a N-hydroxy-containing nitrogen aromatic ring structure, a carbodiimide-type dehydration condensation agent, a 2-halopyridinium-type dehydration condensation agent, and a formamidinium-type dehydration condensation agent.

Classes IPC  ?

• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• C12P 19/34 - Polynucléotides, p. ex. acides nucléiques, oligoribonucléotides

Abrégé

The invention provides an artificial sgRNA and a CRISPR/Cas9 system by combining the artificial sgRNA and Cas9. Activity of the sgRNA can be retained even when a nucleotide linker region for forming a single strand by linking the 3′-terminal of crRNA and the 5′-terminal of tracrRNA in sgRNA is substituted with an amino acid derivative linker, when the linker region existing between stem-loop 1 and stem-loop 2 of tracrRNA and/or the loop portion of stem-loop 2 are/is substituted with an amino acid derivative linker, or when an amino acid derivative linker is added/inserted into the vicinity of the 5′-terminal and/or the 3′-terminal of sgRNA. Stability in vivo can be improved by introducing one or more amino acid derivative linkers into the sgRNA.

Classes IPC  ?

• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 9/22 - Ribonucléases
• C12N 15/90 - Introduction stable d'ADN étranger dans le chromosome
• C07C 229/04 - Composés contenant des groupes amino et carboxyle liés au même squelette carboné ayant des groupes amino et carboxyle liés à des atomes de carbone acycliques du même squelette carboné le squelette carboné étant acyclique et saturé
• C07C 229/34 - Composés contenant des groupes amino et carboxyle liés au même squelette carboné ayant des groupes amino et carboxyle liés à des atomes de carbone acycliques du même squelette carboné le squelette carboné contenant des cycles aromatiques à six chaînons
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• C07F 9/22 - Amides des acides du phosphore
• C40B 50/06 - Procédés biochimiques, p. ex. utilisant des enzymes ou des micro-organismes viables entiers

Abrégé

The present invention provides a novel single-stranded nucleic acid molecule, and a production method therefor. The present invention is related to a production method for a single-stranded nucleic acid molecule represented by general formula (I) (each of the symbols in the formula is as defined in the description).

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7088 - Composés ayant au moins trois nucléosides ou nucléotides
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique

Abrégé

The present invention provides a monoclonal antibody that specifically recognizes an active TGF-β1 and does not recognize a latent TGF-β1 Also provided is a monoclonal antibody that specifically recognizes a latent TGF-β1 or LAP and does not recognize an active TGF-β1. These antibodies are further characterized by non-cross-reactivity with any off-target proteins.

Classes IPC  ?

• C07K 16/22 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des facteurs de croissance
• C12N 15/06 - Cellules animales

Abrégé

The present invention provides a composition containing a single-stranded nucleic acid molecule consisting of a nucleotide sequence shown by 5′-AGCAGAGUACACACAGCAUAUACC-P-GGUAUAUGCUGUGUGUACUCUGCUUC-P-G-3′ (SEQ ID NO: 1) (in the sequence, P is a proline derivative linker represented by (I) in the DESCRIPTION) and a buffer, and having the following features: (b) a content of the nucleic acid molecule after storage at 25° C., relative humidity 60% for 4 weeks, of not less than 80% relative to the content at the time of start of the storage.

Classes IPC  ?

• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61K 31/7125 - Acides nucléiques ou oligonucléotides ayant des liaisons internucléosides modifiées, c.-à-d. autres que des liaisons 3'-5' phosphodiester
• A61K 47/02 - Composés inorganiques
• A61K 47/12 - Acides carboxyliquesLeurs sels ou anhydrides
• A61K 47/16 - Composés organiques, p. ex. hydrocarbures naturels ou synthétiques, polyoléfines, huile minérale, gelée de pétrole ou ozocérite contenant de l'azote
• A61K 47/18 - AminesAmidesUréesComposés d’ammonium quaternaireAcides aminésOligopeptides ayant jusqu’à cinq acides aminés
• A61K 47/26 - Hydrates de carbone, p. ex. polyols ou sucres alcoolisés, sucres aminés, acides nucléiques, mono-, di- ou oligosaccharidesLeurs dérivés, p. ex. polysorbates, esters d’acide gras de sorbitan ou glycyrrhizine
• A61P 11/00 - Médicaments pour le traitement des troubles du système respiratoire
• C07H 21/02 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques avec le ribosyle comme radical saccharide
• C12N 15/09 - Technologie d'ADN recombinant
• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 9/08 - Solutions
• C07H 21/04 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques avec le désoxyribosyle comme radical saccharide

Abrégé

the guide strand sequence and the passenger strand sequence form a double-stranded structure.

Classes IPC  ?

• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61K 47/18 - AminesAmidesUréesComposés d’ammonium quaternaireAcides aminésOligopeptides ayant jusqu’à cinq acides aminés
• A61K 47/34 - Composés macromoléculaires obtenus par des réactions autres que celles faisant intervenir uniquement des liaisons non saturées carbone-carbone, p. ex. polyesters, acides polyaminés, polysiloxanes, polyphosphazines, copolymères de polyalkylène glycol ou de poloxamères
• A61K 47/42 - ProtéinesPolypeptidesLeurs produits de dégradationLeurs dérivés p. ex. albumine, gélatine ou zéine
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61P 35/00 - Agents anticancéreux

Abrégé

The present invention provides: a nucleic acid molecule that effectively inhibits hepatitis B virus gene expression; and a pharmaceutical composition that comprises said nucleic acid molecule and is used for inhibiting hepatitis B virus growth and for treating hepatitis B, hepatic cirrhosis, or hepatic cancer. More specifically, provided is a nucleic acid molecule that includes the nucleotide sequence defined in (i) or (ii) as a sequence for inhibiting the expression of hepatitis B virus gene. (i) Nucleotide sequence represented by SEQ ID NO:2; a nucleotide sequence represented by SEQ ID NO:2, wherein one or two bases are deleted, substituted, inserted, or added; or a nucleotide sequence that has 90% or more identity to the nucleotide sequence represented by SEQ ID NO:2. (ii) Nucleotide sequence represented by SEQ ID NO:1; a nucleotide sequence represented by SEQ ID NO:1, wherein one or two bases are deleted, substituted, inserted, or added; or a nucleotide sequence that has 90% or more identity to the nucleotide sequence represented by SEQ ID NO:1.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 9/02 - SuppositoiresBougiesExcipients pour suppositoires ou bougies
• A61K 9/06 - OnguentsExcipients pour ceux-ci
• A61K 9/08 - Solutions
• A61K 9/10 - DispersionsÉmulsions
• A61K 9/14 - Préparations médicinales caractérisées par un aspect particulier à l'état particulaire, p. ex. poudres
• A61K 9/20 - Pilules, pastilles ou comprimés
• A61K 9/48 - Préparations en capsules, p. ex. de gélatine, de chocolat
• A61K 9/70 - Bases pour bande, feuille ou filament
• A61K 9/72 - Préparations médicinales caractérisées par un aspect particulier à fumer ou inhaler
• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61K 35/76 - VirusParticules sous-viralesBactériophages
• A61K 47/22 - Composés hétérocycliques, p. ex. acide ascorbique, tocophérol ou pyrrolidones
• A61K 47/54 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p. ex. conjugués polymère-médicament l’ingrédient non actif étant un agent de modification l’agent de modification étant un composé organique
• A61P 1/16 - Médicaments pour le traitement des troubles du tractus alimentaire ou de l'appareil digestif des troubles de la vésicule biliaire ou du foie, p. ex. protecteurs hépatiques, cholagogues, cholélitholytiques
• A61P 31/20 - Antiviraux pour le traitement des virus ADN
• A61P 35/00 - Agents anticancéreux
• A61P 43/00 - Médicaments pour des utilisations spécifiques, non prévus dans les groupes
• C12N 15/09 - Technologie d'ADN recombinant

Abrégé

The purpose of the present invention is to provide a nucleic acid molecule having improved stability in serum and capable of entering a cell and exhibiting a function of controlling expression of a gene in the cell. This cyclic nucleic acid molecule represented by formula (A): [in the formula, each symbol is as defined in the description], can be easily synthetized at low cost, and can inhibit translation of a protein encoded by the gene. The cyclic nucleic acid molecule according to the present invention can inhibit the expression of a target gene as described above, and therefore, is useful in, for example, medications, diagnostic agents, and pesticides, and in research tools for agriculture, medicine, life science, etc.

Classes IPC  ?

• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• A61K 31/711 - Acides désoxyribonucléiques naturels, c.-à-d. contenant uniquement des 2'-désoxyriboses liés à l'adénine, la guanine, la cytosine ou la thymine et ayant des liaisons 3'-5' phosphodiester
• A61K 31/7115 - Acides nucléiques ou oligonucléotides ayant des bases modifiées, c.-à-d. autres que l'adénine, la guanine, la cytosine, l'uracile ou la thymine
• A61K 31/713 - Acides nucléiques ou oligonucléotides à structure en double-hélice
• A61K 47/54 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p. ex. conjugués polymère-médicament l’ingrédient non actif étant un agent de modification l’agent de modification étant un composé organique
• A61K 47/65 - Séquences de liaison, liants ou bras-espaceurs peptidiques, p. ex. séquences de liaison peptidiques vulnérable aux protéases
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 43/00 - Médicaments pour des utilisations spécifiques, non prévus dans les groupes

Abrégé

The present invention provides a powdery composition for the administration using a dry powder inhaler, which contains a single-stranded nucleic acid molecule comprising the nucleotide sequence represented by 5'-UAGCACCAUUUGAAAUCAGUGUU-P-AACACUGAUUUCAAAUGGUGCUAGA-3' (SEQ ID NO: 1) (wherein P represents a proline derivative linker represented by formula (I)) and an excipient, wherein the excipient is preferably lactose and/or mannitol. The composition is a powdery preparation containing a nucleic acid that is effective for the treatment of respiratory diseases, and makes it possible to disperse the nucleic acid in lung tissues uniformly when administered using a DPI.

Classes IPC  ?

• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61K 9/14 - Préparations médicinales caractérisées par un aspect particulier à l'état particulaire, p. ex. poudres
• A61K 9/72 - Préparations médicinales caractérisées par un aspect particulier à fumer ou inhaler
• A61K 47/10 - AlcoolsPhénolsLeurs sels, p. ex. glycérolPolyéthylène glycols [PEG]PoloxamèresAlkyléthers de PEG/POE
• A61K 47/22 - Composés hétérocycliques, p. ex. acide ascorbique, tocophérol ou pyrrolidones
• A61K 47/26 - Hydrates de carbone, p. ex. polyols ou sucres alcoolisés, sucres aminés, acides nucléiques, mono-, di- ou oligosaccharidesLeurs dérivés, p. ex. polysorbates, esters d’acide gras de sorbitan ou glycyrrhizine
• A61K 47/54 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p. ex. conjugués polymère-médicament l’ingrédient non actif étant un agent de modification l’agent de modification étant un composé organique
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 11/00 - Médicaments pour le traitement des troubles du système respiratoire

Abrégé

The present invention provides a single-stranded nucleic acid molecule having a delivery function and capable of inhibiting expression of a target gene. The single-stranded nucleic acid molecule of the present invention is a single-stranded nucleic acid molecule composed of a region (Xc), a linker region (Lx) and a region (X), wherein said region (Xc) is complementary to said region (X), at least one of said region (X) and said region (Xc) contains an expression inhibitory sequence that inhibits expression of the target gene, and a bio-related substance having a delivery function is bonded to at least one selected from the group consisting of the 5′-terminus, the 3′-terminus, and said linker region (Lx).

Classes IPC  ?

• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7125 - Acides nucléiques ou oligonucléotides ayant des liaisons internucléosides modifiées, c.-à-d. autres que des liaisons 3'-5' phosphodiester
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 29/00 - Agents analgésiques, antipyrétiques ou anti-inflammatoires non centraux, p. ex. agents antirhumatismauxMédicaments anti-inflammatoires non stéroïdiens [AINS]

Abrégé

The purpose of the present invention is to provide a method for producing a phosphoramidite suitable for nucleic acid production (synthesis) with high efficiency and high purity. A phosphoramidite which allows for efficient nucleic acid synthesis can be obtained using a coupling reaction between a glycoside compound and an ether represented by chemical formula (105), an enantiomer, tautomer, or stereoisomer thereof, or a salt thereof (in the formula, n represents a positive integer, and R and R', which are the same or different, each represent a hydrogen atom or a protecting group for a hydroxy group.)

Classes IPC  ?

• C07H 19/067 - Radicaux pyrimidine avec un ribosyle comme radical saccharide
• C07C 319/14 - Préparation de thiols, de sulfures, d'hydropolysulfures ou de polysulfures de sulfures
• C07C 319/20 - Préparation de thiols, de sulfures, d'hydropolysulfures ou de polysulfures de sulfures par des réactions n'impliquant pas la formation de groupes sulfure
• C07C 323/12 - Thiols, sulfures, hydropolysulfures ou polysulfures substitués par des halogènes, des atomes d'oxygène ou d'azote ou par des atomes de soufre ne faisant pas partie de groupes thio contenant des groupes thio et des atomes d'oxygène, liés par des liaisons simples, liés au même squelette carboné ayant les atomes de soufre des groupes thio liés à des atomes de carbone acycliques du squelette carboné le squelette carboné étant acyclique et saturé
• C07H 19/167 - Radicaux purine avec un ribosyle comme radical saccharide
• C07H 21/02 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques avec le ribosyle comme radical saccharide
• C07H 23/00 - Composés contenant du bore, du silicium ou un métal, p. ex. chélates ou vitamine B12

Abrégé

The present invention provides a novel artificial sgRNA having an activity equal to or higher than that of a natural form sgRNA and improved in stability in vivo, and an efficient CRISPR/Cas9 system by combining the artificial sgRNA and Cas9. Even when a nucleotide linker region for forming a single strand by linking the 3'-terminal of crRNA and the 5'-terminal of tracrRNA in sgRNA is substituted with an amino acid derivative linker, an activity equal to or higher than that of the original sgRNA is retained in an in vitro DNA cleavage assay. Furthermore, even when the linker region existing between stem-loop 1 and stem-loop 2 of tracrRNA and/or the loop portion of stem-loop 2 are/is substituted with an amino acid derivative linker, or even when an amino acid derivative linker is added/inserted into the vicinity of the 5'-terminal and/or the 3'-terminal of sgRNA, an activity equal to or higher than that of the original sgRNA is retained. The stability in vivo can be improved by introducing one or more amino acid derivative linkers into sgRNA.

Classes IPC  ?

• C12N 15/09 - Technologie d'ADN recombinant
• C07C 229/04 - Composés contenant des groupes amino et carboxyle liés au même squelette carboné ayant des groupes amino et carboxyle liés à des atomes de carbone acycliques du même squelette carboné le squelette carboné étant acyclique et saturé
• C07C 229/34 - Composés contenant des groupes amino et carboxyle liés au même squelette carboné ayant des groupes amino et carboxyle liés à des atomes de carbone acycliques du même squelette carboné le squelette carboné contenant des cycles aromatiques à six chaînons
• C12N 9/16 - Hydrolases (3.) agissant sur les liaisons esters (3.1)

Abrégé

Provided are: a novel artificial single guide RNA (sgRNA) that has an activity equal to or higher than the activity of a natural type sgRNA and shows an improved in vivo stability; and an efficient CRISPR/Cas9 system comprising a combination of the artificial sgRNA with a Cas9. When a nucleotide linker moiety for single-strand formation, said nucleotide linker moiety linking the 3'-end of a crRNA to the 5'-end of a tracrRNA in the sgRNA, is substituted by an amino acid derivative linker, the resultant sgRNA still sustains an activity equal to or higher than the activity of the original sgRNA in an in vitro DNA cleavage assay. When a linker region disposed between stem-loop 1 and stem-loop 2 in the tracrRNA and/or the loop moiety of stem-loop 2 are substituted by an amino acid derivative linker, or when an amino acid derivative linker is added/inserted in the vicinity of the 5'-end and/or the 3'-end of the sgRNA, the resultant sgRNA still sustains an activity equal to or higher than the activity of the original sgRNA. By introducing one or more amino acid derivative linkers into the sgRNA, the in vivo stability thereof can be improved.

Classes IPC  ?

• C12N 15/09 - Technologie d'ADN recombinant
• C07C 229/04 - Composés contenant des groupes amino et carboxyle liés au même squelette carboné ayant des groupes amino et carboxyle liés à des atomes de carbone acycliques du même squelette carboné le squelette carboné étant acyclique et saturé
• C07C 229/34 - Composés contenant des groupes amino et carboxyle liés au même squelette carboné ayant des groupes amino et carboxyle liés à des atomes de carbone acycliques du même squelette carboné le squelette carboné contenant des cycles aromatiques à six chaînons
• C12N 9/16 - Hydrolases (3.) agissant sur les liaisons esters (3.1)

Abrégé

The invention provides a single-stranded nucleic acid molecule for inhibiting the expression of a prorenin gene or a prorenin receptor gene, wherein the nucleic acid molecule is characterized in that the nucleic acid molecule comprises only a region (X), a linker region (Lx), and a region (Xc); the linker region (Lx) has a non-nucleotide structure including a pyrrolidine skeleton and/or a piperidine skeleton; and the region (X) and/or the region (Xc) includes a base sequence of at least 18 consecutive bases among any of the prorenin gene expression-inhibiting sequences represented by SEQ ID NOS: 1 to 5 and prorenin receptor gene expression-inhibiting sequences represented by SEQ ID NOS: 6 to 11.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7088 - Composés ayant au moins trois nucléosides ou nucléotides
• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 27/02 - Agents ophtalmiques

Abrégé

The present invention provides a composition containing a buffer solution and a single-stranded nucleic acid molecule that comprises a nucleotide sequence represented by 5'-AGCAGAGUACACACAGCAUAUACC-P-GGUAUAUGCUGUGUGUACUCUGCUUC-P-G-3' (SEQ ID NO: 1) (in the sequence, P indicates a proline derivative linker represented by (I) in the specification), wherein the composition is characterized in that (a) the composition is in the form of a solution at normal temperature, and (b) the nucleic acid molecule content after the composition is stored for four weeks at 25°C and 60% RH is 80% or more relative to the nucleic acid molecule content at the start of storage.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61K 47/02 - Composés inorganiques
• A61K 47/12 - Acides carboxyliquesLeurs sels ou anhydrides
• A61K 47/18 - AminesAmidesUréesComposés d’ammonium quaternaireAcides aminésOligopeptides ayant jusqu’à cinq acides aminés
• A61K 47/26 - Hydrates de carbone, p. ex. polyols ou sucres alcoolisés, sucres aminés, acides nucléiques, mono-, di- ou oligosaccharidesLeurs dérivés, p. ex. polysorbates, esters d’acide gras de sorbitan ou glycyrrhizine
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61K 9/08 - Solutions
• A61P 11/00 - Médicaments pour le traitement des troubles du système respiratoire
• C12N 15/09 - Technologie d'ADN recombinant

Abrégé

The invention provides an artificial match-type miRNA utilizing miRNA. In particular, the invention provides a single strand nucleic acid containing an X region and a Y region, wherein the 3′-terminal of the X region and the 5′-terminal of the Y region are linked via a linker region of a non-nucleotide structure, the X region contains a guide strand sequence of a mature miRNA, and the Y region contains a sequence completely complementary to the X region is an artificial match-type miRNA. The artificial match-type miRNA can suppress expression of the target gene.

Classes IPC  ?

• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/713 - Acides nucléiques ou oligonucléotides à structure en double-hélice

Abrégé

Provided is a single-stranded nucleic acid molecule represented by formula (I): 5'-uagcaccauuugaaaucaguguucc-P-ggaacacugauuucaaauggugcuauu-3' (SEQ ID NO: 1) (in the formula, -P- indicates a proline-derivative linker represented by formula (Ia)). Further provided is a therapeutic agent for corneal diseases such as ocular surface disease, said therapeutic agent having the single-stranded nucleic acid molecule as an active ingredient.

Classes IPC  ?

• C12N 15/09 - Technologie d'ADN recombinant
• A61K 9/127 - Vecteurs à bicouches synthétiques, p. ex. liposomes ou liposomes comportant du cholestérol en tant qu’unique agent tensioactif non phosphatidylique
• A61K 31/7125 - Acides nucléiques ou oligonucléotides ayant des liaisons internucléosides modifiées, c.-à-d. autres que des liaisons 3'-5' phosphodiester
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 27/02 - Agents ophtalmiques
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens

Abrégé

The present invention provides a single-chain nucleic acid molecule having a delivery function and the ability to suppress the expression of a target gene. The single-chain nucleic acid molecule of the present invention comprises a region (Xc), a linker region (Lx) and a region (X), wherein the region (Xc) is complementary to the region (X), the region (X) and/or the region (Xc) includes an expression suppression sequence that suppresses the expression of the target gene, and a bio-related substance having a delivery function is bound to at least one member selected from the group consisting of the 5' end, the 3' end and the linker region (Lx) of the single-chain nucleic acid molecule.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7125 - Acides nucléiques ou oligonucléotides ayant des liaisons internucléosides modifiées, c.-à-d. autres que des liaisons 3'-5' phosphodiester
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 29/00 - Agents analgésiques, antipyrétiques ou anti-inflammatoires non centraux, p. ex. agents antirhumatismauxMédicaments anti-inflammatoires non stéroïdiens [AINS]

Abrégé

　The present invention provides a method for producing glycoside compounds represented by general formula (I) or salts thereof, said method comprising: a step (step 0) in which a thioether compound represented by general formula (103) and an alcohol compound represented by general formula (105) are made to undergo a coupling reaction in the presence of a halogenating agent, a desiccant, and a Lewis acid, and a thioether compound represented by general formula (104) is obtained by distilling the reaction product in the presence of at least one additive selected from a sulfur-containing anti-oxidant and a maleimide group-containing compound; and a step (step 1) in which, in the presence of the halogenating agent, desiccant, and Lewis acid, a glycoside compound represented by general formula (Ia) and the thioether compound represented by general formula (104) are made to undergo a coupling reaction to obtain a glycoside compound represented by general formula (Ib). This method enables phosphoramidites appropriate for the production (synthesis) of nucleic acids to be more efficiently produced with high purity. (Each compound is as defined in the specification.)

Classes IPC  ?

• C07H 19/067 - Radicaux pyrimidine avec un ribosyle comme radical saccharide
• C07H 19/167 - Radicaux purine avec un ribosyle comme radical saccharide

Abrégé

The present invention provides a composition comprising a nucleic acid molecule and a buffer solution, said composition being characterized in that (a) the composition is in the form of a solution at ambient temperature and (b) the content of the nucleic acid molecule in the composition after the composition is stored at 25ºC and a relative humidity of 60% for 4 weeks is 80% or more relative to that in the composition at the time of starting the storage.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7088 - Composés ayant au moins trois nucléosides ou nucléotides
• A61K 47/12 - Acides carboxyliquesLeurs sels ou anhydrides
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique

Abrégé

The present invention provides a naturally occurring miRNA characterized in that: the naturally occurring miRNA is a single-stranded nucleic acid having an X region and a Y region; the 3' end of the X region and the 5' end of the Y region link via a linker region of a non-nucleotide structure; the X region contains (a) a guide strand sequence or (b) a passenger strand sequence of a mature miRNA; in case of (a), the Y region contains a passenger strand sequence of this mature miRNA, whereas in case of (b), the Y region contains a guide strand sequence of this mature miRNA; and the guide strand sequence and passenger strand sequence form a double-stranded structure.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61K 47/18 - AminesAmidesUréesComposés d’ammonium quaternaireAcides aminésOligopeptides ayant jusqu’à cinq acides aminés
• A61K 47/34 - Composés macromoléculaires obtenus par des réactions autres que celles faisant intervenir uniquement des liaisons non saturées carbone-carbone, p. ex. polyesters, acides polyaminés, polysiloxanes, polyphosphazines, copolymères de polyalkylène glycol ou de poloxamères
• A61K 47/42 - ProtéinesPolypeptidesLeurs produits de dégradationLeurs dérivés p. ex. albumine, gélatine ou zéine
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique

Abrégé

The present invention provides a single-stranded nucleic acid molecule of (A) or (B) including a TGF-β1 gene-expression-inhibiting sequence represented by SEQ ID NO: 1 or 2: (SEQ ID NO: 1) 5'- AUUUCGUUGUGGGUUUCCACC -3' (SEQ ID NO: 2) 5'- UGUUAUCCCUGCUGUCACAGG -3'. (A) comprises only region (X), linker region (Lx), and region (Xc), the region (Xc), linker region (Lx), and region (X) being arranged in the stated order from the 5' side to the 3' side; the linker region (Lx) has a non-nucleotide structure that includes a pyrrolidine skeleton and/or a piperidine skeleton; and at least one of region (X) and region (Xc) includes the abovementioned expression-inhibiting sequence. (B) includes region (Xc), linker region (Lx), region (X), region (Y), linker region (Ly), and region (Yc) in the stated order from the 5' side to the 3' side; region (X) and region (Y) link to form an internal region (Z); region (Xc) is complementary to region (X); region (Yc) is complementary to region (Y); linker region (Lx) and linker region (Ly) have a non-nucleotide structure including a pyrrolidine skeleton and/or a piperidine skeleton; and internal region (Z) includes the abovementioned expression-inhibiting sequence.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 11/00 - Médicaments pour le traitement des troubles du système respiratoire
• A61P 43/00 - Médicaments pour des utilisations spécifiques, non prévus dans les groupes
• C12N 15/09 - Technologie d'ADN recombinant

Abrégé

The present invention provides a novel artificial match-type miRNA that uses miRNA. The artificial match-type miRNA is a single-stranded nucleic acid comprising an X region and a Y region and is configured such that: the 3'-end of the X region and the 5'-end of the Y region are connected via a linker region having a non-nucleotide structure; the X region comprises a mature miRNA guide strand sequence; and the Y region is a single-stranded nucleic acid comprising a sequence that is completely complementary to the X region. This artificial match-type miRNA makes it possible to inhibit the expression of a target gene.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7088 - Composés ayant au moins trois nucléosides ou nucléotides
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 35/00 - Agents anticancéreux
• A61P 43/00 - Médicaments pour des utilisations spécifiques, non prévus dans les groupes

Abrégé

The present invention provides an artificial match-type miRNA that is a single-stranded nucleic acid comprising an X region and a Y region and that is characterized in that: the 3'-end of the X region and the 5'-end of the Y region are connected via a non-nucleotide structure that comprises at least one of a pyrrolidine skeleton and a piperidine skeleton; the X region comprises an hsa-miR-34 mature miRNA guide strand sequence; and the Y region comprises a sequence that is perfectly complementary to the X region. This artificial match-type miRNA makes it possible to inhibit the expression of a target gene.

Classes IPC  ?

• C12N 15/09 - Technologie d'ADN recombinant
• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61P 35/00 - Agents anticancéreux
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens

Abrégé

　The present invention provides a single-stranded nucleic acid molecule for inhibiting the expression of the TGF-β1 gene, said molecule being characterized by comprising only a region (X), a linker region (Lx) and a region (Xc), wherein the linker region (Lx) has a non-nucleotide structure containing a pyrrolidine skeleton and/or a piperidine skeleton, and at least one of the region (X) and the region (Xc) includes an expression-inhibiting sequence that inhibits the expression of the TGF-β1 gene. The present invention further provides a therapeutic pharmaceutical composition for pulmonary fibrosis or acute lung injury that contains the single-stranded nucleic acid molecule.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7088 - Composés ayant au moins trois nucléosides ou nucléotides
• A61K 31/713 - Acides nucléiques ou oligonucléotides à structure en double-hélice
• A61K 47/22 - Composés hétérocycliques, p. ex. acide ascorbique, tocophérol ou pyrrolidones
• A61K 47/48 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p.ex. supports, additifs inertes l'ingrédient non actif étant chimiquement lié à l'ingrédient actif, p.ex. conjugués polymère-médicament
• A61P 11/00 - Médicaments pour le traitement des troubles du système respiratoire
• A61P 43/00 - Médicaments pour des utilisations spécifiques, non prévus dans les groupes

Abrégé

The invention provides a single-stranded nucleic acid capable of inhibiting expression of a target gene having a delivery function. The nucleic acid contains, from the 5′-side to the 3′-side, a 5′-side region (Xc), a linker region (Lx), an inner region (Z), a linker region (Ly) and a 3′-side region (Yc) in this order, wherein the inner region (Z) is constituted by linkage of the inner 5′-side region (X) and the inner 3′-side region (Y), the 5′-side region (Xc) is complementary to the inner 5′-side region (X), the 3′-side region (Yc) is complementary to the inner 3′-side region (Y), at least one of the inner region (Z), the 5′-side region (Xc) and the 3′-side region (Yc) comprises an expression inhibitory sequence that inhibits expression of a target gene, and at least one of the 5′-terminus, the 3′-terminus, the linker region (Lx) and the linker region (Ly) is bound to a bio-related substance.

Classes IPC  ?

• A61K 47/48 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p.ex. supports, additifs inertes l'ingrédient non actif étant chimiquement lié à l'ingrédient actif, p.ex. conjugués polymère-médicament
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique

Abrégé

The invention provides a microRNA inhibitor that has two or more sequences complementary to the sequence of microRNA to be the target of inhibition, which two or more complementary sequences are linked via one or more linker residues.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C07F 9/22 - Amides des acides du phosphore
• A61K 47/48 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p.ex. supports, additifs inertes l'ingrédient non actif étant chimiquement lié à l'ingrédient actif, p.ex. conjugués polymère-médicament

Abrégé

The invention provides a single-stranded nucleic acid molecule containing an expression inhibitory sequence that inhibits expression of a target gene, region (X), linker region (Lx), and region (Xc), wherein the linker region (Lx) is linked between the region (Xc) and the region (Xc), the region (Xc) is complementary to the region (X), at least one of the region (X) and the region (Xc) contains the expression inhibitory sequence, and the linker region (Lx) contains an atomic group derived from an amino acid. The single-stranded nucleic acid molecule can inhibit expression of the target gene.

Classes IPC  ?

• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• C07C 225/06 - Composés contenant des groupes amino et des atomes d'oxygène, liés par des liaisons doubles, liés au même squelette carboné, au moins un des atomes d'oxygène, liés par des liaisons doubles, ne faisant pas partie d'un groupe —CHO, p. ex. aminocétones ayant des groupes amino liés à des atomes de carbone acycliques du squelette carboné le squelette carboné étant saturé et acyclique
• A61K 47/48 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p.ex. supports, additifs inertes l'ingrédient non actif étant chimiquement lié à l'ingrédient actif, p.ex. conjugués polymère-médicament

Abrégé

Provided is a novel nucleic acid molecule that can be produced easily and efficiently and can inhibit the expression of a gene. The nucleic acid molecule is a single-stranded nucleic acid molecule including an expression inhibitory sequence that inhibits expression of a target gene. The single-stranded nucleic acid molecule includes: a region (X); a linker region (Lx); and a region (Xc). The linker region (Lx) is linked between the regions (Xc) and (Xc). The region (Xc) is complementary to the region (X). At least one of the regions (X) and (Xc) includes the expression inhibitory sequence. The linker region (Lx) has a non-nucleotide structure including at least one of a pyrrolidine skeleton and a piperidine skeleton. According to this single-stranded nucleic acid molecule, it is possible to inhibit the expression of the target gene.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• C12N 15/63 - Introduction de matériel génétique étranger utilisant des vecteursVecteurs Utilisation d'hôtes pour ceux-ciRégulation de l'expression
• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61K 31/7125 - Acides nucléiques ou oligonucléotides ayant des liaisons internucléosides modifiées, c.-à-d. autres que des liaisons 3'-5' phosphodiester
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C07F 9/22 - Amides des acides du phosphore

Abrégé

Provided is a novel nucleic acid molecule that can be produced easily and efficiently and can inhibit the expression of a gene. The nucleic acid molecule is a single-stranded nucleic acid molecule including an expression inhibitory sequence that inhibits expression of a target gene. The single-stranded nucleic acid molecule includes: a region (X); a linker region (Lx); and a region (Xc). The linker region (Lx) is linked between the regions (Xc) and (Xc). The region (Xc) is complementary to the region (X). At least one of the regions (X) and (Xc) includes the expression inhibitory sequence. The linker region (Lx) has a non-nucleotide structure including at least one of a pyrrolidine skeleton and a piperidine skeleton. According to this single-stranded nucleic acid molecule, it is possible to inhibit the expression of the target gene.

Classes IPC  ?

• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61K 31/7125 - Acides nucléiques ou oligonucléotides ayant des liaisons internucléosides modifiées, c.-à-d. autres que des liaisons 3'-5' phosphodiester
• C07F 9/22 - Amides des acides du phosphore

Abrégé

Provided is a single-stranded nucleic acid which can inhibit the expression of a target gene having a delivering function. A molecule characterized by comprising a 5'-side region (Xc), a linker region (Lx), an internal region (Z), a linker region (Ly) and a 3'-side region (Yc) in this order when observed in the direction from the 5'-side toward the 3'-side, wherein the internal region (Z) is composed of an internal 5'-side region (X) and an internal 3'-side region (Y) linked to each other, the 5'-side region (Xc) is complementary to the internal 5'-side region (X), the 3'-side region (Yc) is complementary to the internal 3'-side region (Y), at least one selected from the internal region (Z), the 5'-side region (Xc) and the 3'-side region (Yc) contains an expression-inhibiting sequence that inhibits the expression of a target gene, and a biological substance is bound to at least one selected from the group consisting of the 5'-terminal, the 3'-terminal, the linker region (Lx) and the linker region (Ly).

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 47/48 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p.ex. supports, additifs inertes l'ingrédient non actif étant chimiquement lié à l'ingrédient actif, p.ex. conjugués polymère-médicament
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 43/00 - Médicaments pour des utilisations spécifiques, non prévus dans les groupes
• C12N 15/09 - Technologie d'ADN recombinant

Abrégé

Provided is a micro-RNA inhibitor which has broad utility and is rarely decomposed. A micro-RNA inhibitor (1) characterized by having at least two complementary sequences (2) to the sequence for micro-RNA to be inhibited, wherein the at least two complementary sequences (2) are linked to each other through a linker residue (3).

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7088 - Composés ayant au moins trois nucléosides ou nucléotides
• A61K 47/48 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p.ex. supports, additifs inertes l'ingrédient non actif étant chimiquement lié à l'ingrédient actif, p.ex. conjugués polymère-médicament
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 43/00 - Médicaments pour des utilisations spécifiques, non prévus dans les groupes

Abrégé

　Provided is a new nucleic acid molecule that inhibits the activity of TLR 3 and the expression of the VEGF gene. The single-stranded nucleic acid molecule for inhibiting the expression of the VEGF gene is characterized in that: a 5'-side region (Xc), an internal region (Z) and a 3'-side region (Yc) are included, in that order, from the 5' side to the 3' side; the internal region (Z) is formed by linking an internal 5'-side region (X) and an internal 3'-side region (Y); the 5'-side region (Xc) is complementary to the internal 5'-side region (X); the 3'-side region (Yc) is complementary to the internal 3'-side region (Y); and at least one region among the internal region (Z), the 5'-side region and the 3'-side region includes an expression-inhibiting sequence that inhibits the expression of the VEGF gene. The single-stranded nucleic acid molecule is capable of inhibiting the activity of TLR 3 and the expression of the VEGF gene.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7105 - Acides ribonucléiques naturels, c.-à-d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 27/02 - Agents ophtalmiques
• A61P 35/00 - Agents anticancéreux
• C12Q 1/68 - Procédés de mesure ou de test faisant intervenir des enzymes, des acides nucléiques ou des micro-organismesCompositions à cet effetProcédés pour préparer ces compositions faisant intervenir des acides nucléiques

Abrégé

The purpose of the invention is to provide a novel nucleic acid molecule that can be produced easily and efficiently and makes it possible to suppress the expression of a gene. A single-stranded nucleic acid molecule containing an expression suppression sequence for suppressing the expression of a target gene, the molecule being characterized by containing a region (X), linker region (Lx), and region (Xc). The linker region (Lx) is connected between the region (Xc) and the region (X), the region (Xc) is complementary with the region (X), the region (X) and/or the region (Xc) contains the expression suppression sequence, and the linker region (Lx) contains an atomic group derived from an amino acid. The single-stranded nucleic acid molecule makes it possible to suppress the expression of the target gene.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• C07C 225/06 - Composés contenant des groupes amino et des atomes d'oxygène, liés par des liaisons doubles, liés au même squelette carboné, au moins un des atomes d'oxygène, liés par des liaisons doubles, ne faisant pas partie d'un groupe —CHO, p. ex. aminocétones ayant des groupes amino liés à des atomes de carbone acycliques du squelette carboné le squelette carboné étant saturé et acyclique

Abrégé

Provided is a novel nucleic acid molecule capable of suppressing the expression of a gene. A single-stranded nucleic acid molecule containing an expression-suppressing sequence for a target gene and a complementary sequence having a mismatch with the expression-suppressing sequence, wherein a 5'-side region (Xc), an internal region (Z) and a 3'-side region (Yc) are contained in this order from the 5'-side toward the 3'-side, the region (Z) is formed by linking an internal 5'-side region (X) to an internal 3'-side region (Y), the region (Xc) is complementary to the region (X), the region (Yc) is complementary to the region (Y), at least one of the region (Z), the region (Xc) and the region (Yc) contains the expression-suppressing sequence, a region complementary to the region containing the expression-suppressing sequence contains the complementary sequence, and a 5'-terminal nucleotide and a 3'-terminal nucleotide in the single-stranded nucleic acid molecule are not bound to each other. The single-stranded nucleic acid molecule can suppress the expression of the target gene.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61K 31/7088 - Composés ayant au moins trois nucléosides ou nucléotides
• A61P 35/00 - Agents anticancéreux

Abrégé

Provided is a glucoside compound that can be produced inexpensively and is capable of imparting a phosphoramidite with which a nucleic acid can be produced at a high yield and high purity. The glucoside compound is represented by chemical formula (1). (1) In chemical formula (1), B is an atomic group having a nucleic acid base skeleton, and optionally having protector groups; R1 and R2 are each a hydrogen group or a protector group, or together form an atomic group represented by the chemical formula (R1R2A) or (R1R2B) (R1R2A) (R1R2B) each R1a is a hydrogen atom or linear or branched alkyl group, and the like; L1 is an unsubstituted or alkyl-substituted ethylene group; and R3 is a group represented by the following chemical formula (R3), where n in chemical formula (R3) is a positive integer and [D1] is an electron-attracting group.

Classes IPC  ?

• C07H 19/067 - Radicaux pyrimidine avec un ribosyle comme radical saccharide
• B01J 31/02 - Catalyseurs contenant des hydrures, des complexes de coordination ou des composés organiques contenant des composés organiques ou des hydrures métalliques
• C07C 319/14 - Préparation de thiols, de sulfures, d'hydropolysulfures ou de polysulfures de sulfures
• C07C 319/20 - Préparation de thiols, de sulfures, d'hydropolysulfures ou de polysulfures de sulfures par des réactions n'impliquant pas la formation de groupes sulfure
• C07C 323/12 - Thiols, sulfures, hydropolysulfures ou polysulfures substitués par des halogènes, des atomes d'oxygène ou d'azote ou par des atomes de soufre ne faisant pas partie de groupes thio contenant des groupes thio et des atomes d'oxygène, liés par des liaisons simples, liés au même squelette carboné ayant les atomes de soufre des groupes thio liés à des atomes de carbone acycliques du squelette carboné le squelette carboné étant acyclique et saturé
• C07H 19/167 - Radicaux purine avec un ribosyle comme radical saccharide
• C07B 61/00 - Autres procédés généraux
• C12N 15/09 - Technologie d'ADN recombinant

Abrégé

A process for easily preparing a phosphate compound bearing an isotope is provided. This process includes an oxidation step of oxidizing a trivalent-phosphorus compound with an oxidizing agent that contains an isotope to synthesize a pentavalent-phosphorus compound into which the isotope has been introduced. The process is preferably applied to the synthesis of nucleic acids such as DNA and RNA. The isotope is preferably a stable isotope. The oxidizing agent is preferably H218O, 34S-bearing 3H-1,2-benzodithiol-3-one-1,1-dioxide, or 10B-bearing diisopropylethylamine borane complex.

Classes IPC  ?

• C07H 1/02 - Phosphorylation
• C07H 21/02 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques avec le ribosyle comme radical saccharide
• C07B 59/00 - Introduction d'isotopes d'éléments dans les composés organiques

Abrégé

Provided is a novel nucleic acid molecule that can be produced easily and efficiently and can inhibit the expression of a gene. The nucleic acid molecule is a single-stranded nucleic acid molecule including an expression inhibitory sequence that inhibits expression of a target gene. The single-stranded nucleic acid molecule includes: a region (X); a linker region (Lx); and a region (Xc). The linker region (Lx) is linked between the regions (Xc) and (Xc). The region (Xc) is complementary to the region (X). At least one of the regions (X) and (Xc) includes the expression inhibitory sequence. The linker region (Lx) has a non-nucleotide structure including at least one of a pyrrolidine skeleton and a piperidine skeleton. According to this single-stranded nucleic acid molecule, it is possible to inhibit the expression of the target gene.

Classes IPC  ?

• A01N 43/04 - Biocides, produits repoussant ou attirant les animaux nuisibles, ou régulateurs de croissance des végétaux, contenant des composés hétérocycliques comportant des cycles avec un ou plusieurs atomes d'oxygène ou de soufre comme uniques hétéro-atomes du cycle avec un hétéro-atome
• C07H 19/044 - Radicaux pyrrole
• C12Q 1/68 - Procédés de mesure ou de test faisant intervenir des enzymes, des acides nucléiques ou des micro-organismesCompositions à cet effetProcédés pour préparer ces compositions faisant intervenir des acides nucléiques
• C12N 15/63 - Introduction de matériel génétique étranger utilisant des vecteursVecteurs Utilisation d'hôtes pour ceux-ciRégulation de l'expression
• C07H 21/04 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques avec le désoxyribosyle comme radical saccharide

Abrégé

The purpose of the present invention is to provide a novel nucleic acid molecule which can be easily and efficiently produced and is capable of inhibiting the expression of a gene. A single-stranded nucleic acid molecule which contains an expression inhibitory sequence, said expression inhibitory sequence being capable of inhibiting the expression of a target gene, and comprises a region (X), a linker region (Lx) and a region (Xc), characterized in that: the linker region (Lx) is linked between the region (X) and the region (Xc); the region (Xc) is complementary to the region (X); the region (X) and/or the region (Xc) contain said expression inhibitory sequence; and the linker region (Lx) has a non-nucleotide structure containing a pyrrolidine skeleton and/or a piperidine skeleton. This single-stranded nucleic acid molecule can inhibit the expression of the aforesaid target gene.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• C07D 207/08 - Composés hétérocycliques contenant des cycles à cinq chaînons, non condensés avec d'autres cycles, ne comportant qu'un atome d'azote comme unique hétéro-atome du cycle avec uniquement des atomes d'hydrogène ou de carbone liés directement à l'atome d'azote du cycle ne comportant pas de liaison double entre chaînons cycliques ou entre chaînons cycliques et chaînons non cycliques avec des radicaux hydrocarbonés, substitués par des hétéro-atomes, liés aux atomes de carbone du cycle

Abrégé

Provided is a novel nucleic acid molecule that is a single-stranded nucleic acid molecule including an expression inhibitory sequence that inhibits expression of a target gene. The single-stranded nucleic acid molecule includes, in sequence from the 5′ side to the 3′ side: a 5′ side region (Xc); an inner region (Z); and a 3′ side region (Yc). The inner region (Z) is composed of an inner 5′ side region (X) and an inner 3′ side region (Y) that are linked to each other. The 5′ side region (Xc) is complementary to the inner 5′ side region (X). The 3′ side region (Yc) is complementary to the inner 3′ side region (Y). At least one of the inner region (Z), the 5′ side region (Xc), and the 3′ side region (Yc) includes the expression inhibitory sequence.

Classes IPC  ?

• C12Q 1/68 - Procédés de mesure ou de test faisant intervenir des enzymes, des acides nucléiques ou des micro-organismesCompositions à cet effetProcédés pour préparer ces compositions faisant intervenir des acides nucléiques
• C12P 19/34 - Polynucléotides, p. ex. acides nucléiques, oligoribonucléotides
• C12N 15/63 - Introduction de matériel génétique étranger utilisant des vecteursVecteurs Utilisation d'hôtes pour ceux-ciRégulation de l'expression
• C07H 21/02 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques avec le ribosyle comme radical saccharide
• C07H 21/04 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques avec le désoxyribosyle comme radical saccharide

Abrégé

Disclosed is a novel nucleic acid molecule capable of suppressing expression of a gene and capable of easy and efficient manufacture. The single-strand nucleic acid molecule contains an expression suppression sequence that inhibits expression of a target gene, and contains, in order from the 5' end to the 3' end, a 5' end region (Xc), an inner region (Z) and a 3' end region (Yc), wherein the inner region (Z) is constituted by linking an inner 5' end region (X) and an inner 3' end region (Y), the 5' end region (Xc) is complementary to the inner 5' end region (X), the 3' end region (Yc) is complementary to the inner 3' end region (Y), and at least one of the inner region (Z), the 5' end region and the 3' end region includes the aforementioned expression suppression sequence. By means of this single-strand nucleic acid molecule, expression of the target gene can be suppressed.

Classes IPC  ?

• C12N 15/09 - Technologie d'ADN recombinant
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 29/00 - Agents analgésiques, antipyrétiques ou anti-inflammatoires non centraux, p. ex. agents antirhumatismauxMédicaments anti-inflammatoires non stéroïdiens [AINS]
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens