Abrégé

The present invention relates to a method for diagnosing or identifying a colorectal cancer in a subject, through the detection of the abnormal hypermethylation levels of specific genes in a biological sample of said subject. The inventors indeed identified DNA methylation biomarkers that, alone or in combination, can help diagnosing or following-up colorectal cancer patients. Further, it can be used for determining, and/or adapting a suitable therapeutic regimen for a subject diagnosed for colorectal cancer. The present invention also relates to kits comprising primers or probes to detect, diagnose, or identify hypermethylated genes.

Classes IPC  ?

• C12Q 1/6886 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p.ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique pour le cancer

Abrégé

The present application relates to pyrazole derivatives as PD-1/PD-L1 interaction inhibitors. The applicants designed compounds of general formula (I), wherein R', R2, y3, R3, R4, R5, R6and R7in vitroin vitro biological tests (FRET assay, Promega Blockade assay, T cell assay). These compounds had an affinity (Kd) of the order of pM that was higher than that of the antibody atezolizumab used in clinical use, and had a comparable or better IC50 than that observed with atezolizumab. Thus, the present invention also relates to a pharmaceutical composition comprising said compound(s) and their uses in the treatment of PD-1-PD-L1 interactions-related diseases (cancer, chronic inflammatory diseases, neurological diseases and chronic infections).

Classes IPC  ?

• A61P 25/00 - Médicaments pour le traitement des troubles du système nerveux
• A61P 29/00 - Agents analgésiques, antipyrétiques ou anti-inflammatoires non centraux, p.ex. agents antirhumatismaux; Médicaments anti-inflammatoires non stéroïdiens [AINS]
• A61P 31/00 - Agents anti-infectieux, c. à d. antibiotiques, antiseptiques, chimiothérapeutiques
• A61P 35/00 - Agents anticancéreux
• C07D 231/40 - Atomes d'azote acylés sur ledit atome d'azote
• C07D 401/04 - Composés hétérocycliques contenant plusieurs hétérocycles comportant des atomes d'azote comme uniques hétéro-atomes du cycle, au moins un cycle étant un cycle à six chaînons avec un unique atome d'azote contenant deux hétérocycles liés par une liaison directe de chaînon cyclique à chaînon cyclique
• C07D 403/10 - Composés hétérocycliques contenant plusieurs hétérocycles, comportant des atomes d'azote comme uniques hétéro-atomes du cycle, non prévus par le groupe contenant deux hétérocycles liés par une chaîne carbonée contenant des cycles aromatiques
• C07D 413/12 - Composés hétérocycliques contenant plusieurs hétérocycles, au moins un cycle comportant des atomes d'azote et d'oxygène comme uniques hétéro-atomes du cycle contenant deux hétérocycles liés par une chaîne contenant des hétéro-atomes comme chaînons
• A61K 31/415 - 1,2-Diazoles
• A61K 31/4439 - Pyridines non condensées; Leurs dérivés hydrogénés contenant d'autres systèmes hétérocycliques contenant un cycle à cinq chaînons avec l'azote comme hétéro-atome du cycle, p.ex. oméprazole
• A61K 31/496 - Pipérazines non condensées contenant d'autres hétérocycles, p.ex. rifampine, thiothixène
• A61K 31/5355 - Oxazines non condensées contenant d'autres hétérocycles

Abrégé

The present application provides means for associating Transposal Elements (TEs) expression in T cells with a stage of T cell differentiation. The present application also relates to methods for differentiating progenitor exhausted T cells (Tpex) from Terminally exhausted T cells (Tex). The present invention is also related to methods and means for identifying Tpex from Tex by analysing Transcription Factor Fli1 expression. The present invention is also related to the use of TEs expression and/or Fli1 expression in T cells, in particular in Tpex and Tex, as biomarker(s) of the likeliness to positively respond to immunotherapy, in particular in a patient having a cancer or a chronic viral infection, in particular in response to an anti-PD-1 or anti-PD-L1 immunotherapy.

Classes IPC  ?

• C12Q 1/6886 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p.ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique pour le cancer

Abrégé

Cancer progression involves changes in the composition of the lysosomal membrane. Under those stress conditions, several adaptive responses are activated to support cell survival, such as the transcription factor EB (TFEB) to drive the expression of lysosomal and autophagy related genes. In cases where these adaptive stress responses fail to cope with lysosomal stress, the induction of lysosomal damage can result in cell death. In the present invention, the inventors used 1200 FDA approved compounds for a high-content imaged-based screen to search new TFEB inducers and autophagy activators. They identified two compounds (Sertraline and Indatraline) that, despite the activation of TFEB and the high levels of LC3 puncta, elicited a significant cytotoxic effect in cancer cell lines. The data showed that both compounds inhibited autophagy flux partially and subsequently generated a significant induction of lysosomal membrane permeabilization and cell death. Finally, the inventors demonstrated that the compounds elicited immunogenic cell death features and mice that were vaccinated with these compounds were protected against tumor growth. These results indicate that both compounds have a stimulating effect on immunity against cancer.

Classes IPC  ?

• A61K 31/135 - Amines, p.ex. amantadine ayant des cycles aromatiques, p.ex. méthadone
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p.ex. composés antiphlogistiques et pour le cœur 
• A61P 35/00 - Agents anticancéreux
• A61P 37/04 - Immunostimulants

Abrégé

The present invention relates to functional N-terminal truncated GDE polypeptides for the treatment of glycogen storage disease III.

Classes IPC  ?

• C12N 9/10 - Transférases (2.)
• A61K 38/00 - Préparations médicinales contenant des peptides
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiques; Thérapie génique
• C12N 9/44 - Hydrolases (3.) agissant sur les composés glycosyliques (3.2) agissant sur les liaisons alpha-glucosidiques-1, 6, p.ex. iso-amylase, pullulanase
• C12N 15/52 - Gènes codant pour des enzymes ou des proenzymes
• C12N 15/63 - Introduction de matériel génétique étranger utilisant des vecteurs; Vecteurs; Utilisation d'hôtes pour ceux-ci; Régulation de l'expression
• C12N 15/86 - Vecteurs viraux

Abrégé

METHODS OF TREATMENT OF METABOLIC DISORDERS In the present invention SLC5A9 gene (encoding SGLT4 protein) regulation was analyzed in the intestine of patients before and after weight-loss surgery. RNA scope analysis was used to determine the precise location of SLC5A9 in the human intestine and pancreas. Sglt4 knock- out (KO) mice were created using CRISPR/Cas techniques, allowing to study changes in their metabolic phenotype for months while they were fed the WD (Western Diet). So, these data demonstrate that SLC5A9 mRNA levels are induced in the apical membrane of the intestine and exocrine pancreas in persons with obesity and Type 2 Diabetes. Furthermore, Sglt4 deficiency slows the onset of obesity and hyperglycemia in mice fed the WD, improving insulin sensitivity by improving beta cell function. Accordingly the present invention relates to a method for preventing or treating metabolic disorders by targeting the Sodium-Glucose-Co- Transporter-4 (SGTL4).

Classes IPC  ?

• A61K 38/17 - Peptides ayant plus de 20 amino-acides; Gastrines; Somatostatines; Mélanotropines; Leurs dérivés provenant d'humains
• A61P 1/16 - Médicaments pour le traitement des troubles du tractus alimentaire ou de l'appareil digestif des troubles de la vésicule biliaire ou du foie, p.ex. protecteurs hépatiques, cholagogues, cholélitholytiques
• A61K 31/713 - Acides nucléiques ou oligonucléotides à structure en double-hélice
• A61K 31/7105 - Acides ribonucléiques naturels, c. à d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester 
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p.ex. oligonucléotides anti-sens
• C40B 30/06 - Procédés de criblage des bibliothèques en mesurant les effets sur des cellules, des tissus ou des organismes vivants
• G01N 33/15 - Préparations médicinales
• A61P 3/00 - Médicaments pour le traitement des troubles du métabolisme
• A61P 3/04 - Anorexigènes; Médicaments de l'obésité
• A61P 3/08 - Médicaments pour le traitement des troubles du métabolisme de l'homéostase du glucose
• A61P 5/48 - Médicaments pour le traitement des troubles du système endocrinien des hormones pancréatiques
• A61P 13/12 - Médicaments pour le traitement des troubles du système urinaire des reins

Abrégé

A fusion protein including fragments of the spike protein and of the nucleoprotein of a coronavirus. Also a vaccine, a composition, a pharmaceutical composition, or a diagnostic kit including the fusion protein, a method for diagnosing an infection by a coronavirus and to a method for preventing or treating a coronavirus infection based on the use of the fusion protein.

Classes IPC  ?

• A61K 39/215 - Coronaviridae, p.ex. virus de la bronchite infectieuse aviaire
• A61K 39/00 - Préparations médicinales contenant des antigènes ou des anticorps
• A61P 37/04 - Immunostimulants
• C07K 14/005 - Peptides ayant plus de 20 amino-acides; Gastrines; Somatostatines; Mélanotropines; Leurs dérivés provenant de virus
• G01N 33/569 - Tests immunologiques; Tests faisant intervenir la formation de liaisons biospécifiques; Matériaux à cet effet pour micro-organismes, p.ex. protozoaires, bactéries, virus

Abrégé

Inventors analyzed the prognostic value of tumor and stromal-derived SPARC in a large series that included 148 non-metastatic TNBC patients with a long follow-up by immunohistochemistry. They show that SPARC expression was detected in cancer cells (42.4%), cancer-associated fibroblasts (CATs) (88.1%). TAMs (77.1%), endothelial cells (75.2%) and TILs (9.8%). Recurrence-free survival (RFS) was significantly lower for patients with a positive expression of SPARC in CATs (SPARC+CATs) with a median follow-up of 5.4 years. SPARC expression in CATs was found to be an independent prognostic factor in multivariate analysis. Accordingly, the present invention relates to a method for predicting the survival time of a subject suffering from triple-negative breast cancer (TNBC) comprising determining the expression level of Secreted Protein Acidic and Rich in Cysteine (SPARC) in cancer-associated fibroblasts (CATs) in a biological sample obtained from the subject wherein said positive expression of SPARC in CATs (SPARC+CAFs) correlates with a short survival time of the subject.

Classes IPC  ?

• G01N 33/574 - Tests immunologiques; Tests faisant intervenir la formation de liaisons biospécifiques; Matériaux à cet effet pour le cancer

Abrégé

The present invention relates to a compound of formula (I), wherein n = 1 or 2, and A and A' are independently chosen from among the group consisting of the following substituents (ll-a) and (ll-b), R and R' being independently chosen from among H and C1-C3 linear or branched alkyls, Z being chosen from among a C1-C4 linear or branched alkyl group and an aryl group optionally substituted with a C1-C3 linear or branched alkyl group or/and with a hydroxyl group, and the unit of formula (N) is chosen from among the following units (III-a), (III-b), (III-c), (III-d) and (III-e), Ra, Rb, Rc and Rd being, for each unit (lll-a), (lll-b), (lll-c), (lll-d) and (lll-e), independently chosen from among C1-C4 linear or branched alkyls.

Classes IPC  ?

• C07D 207/46 - Composés hétérocycliques contenant des cycles à cinq chaînons, non condensés avec d'autres cycles, ne comportant qu'un atome d'azote comme unique hétéro-atome du cycle avec les hétéro-atomes liés directement à l'atome d'azote du cycle
• C07D 209/44 - Iso-indoles; Iso-indoles hydrogénés
• C07D 405/12 - Composés hétérocycliques contenant à la fois un ou plusieurs hétérocycles comportant des atomes d'oxygène comme uniques hétéro-atomes du cycle et un ou plusieurs hétérocycles comportant des atomes d'azote comme uniques hétéro-atomes du cycle contenant deux hétérocycles liés par une chaîne contenant des hétéro-atomes comme chaînons
• C07D 211/94 - Atome d'oxygène, p.ex. N-oxyde de pipéridine
• A61K 49/06 - Préparations de contraste pour la résonance magnétique nucléaire (RMN); Préparations de contraste pour l'imagerie par résonance magnétique (IRM)
• A61B 5/00 - Mesure servant à établir un diagnostic ; Identification des individus
• G01N 24/00 - Recherche ou analyse des matériaux par l'utilisation de la résonance magnétique nucléaire, de la résonance paramagnétique électronique ou d'autres effets de spin

Abrégé

The present invention relates to extracellular vesicles derived from regulatory B cells, and the use thereof in therapy.

Classes IPC  ?

• A61K 35/12 - Substances provenant de mammifères; Compositions comprenant des tissus ou des cellules non spécifiés; Compositions comprenant des cellules souches non embryonnaires; Cellules génétiquement modifiées
• C12N 5/0781 - Cellules B; Leurs progéniteurs

Abrégé

The present invention relates to a device for obtaining a trained machine learning segmentation model for carotid segmentation using positron emission tomography (PET) images of a patient and to a device and a computer-implemented method for carotid segmentation of positron emission tomography (PET) frames previously acquired on a patient using the trained machine learning segmentation model (31) for carotid segmentation, wherein said segmentation model is configured to provide a segmentation mask of the at least one portion of interest of the carotid arteries.

Classes IPC  ?

• G06T 7/174 - Découpage; Détection de bords impliquant l'utilisation de plusieurs images
• A61B 6/03 - Tomographes assistés par ordinateur
• G06T 7/11 - Découpage basé sur les zones

Abrégé

Compound of the 7a,8,9,10,11,1la-hexahydro-1H,7H-pyrano[2,3-c]xanthene type, method of preparation thereof, intermediates thereof and therapeutic applications thereof. The present invention relates to compounds of formula (I) in which R0 represents O or N—ORa, R1 is OH or protected OH, R2 R3 R4 represent, independently, a C1-C4 alkyl, R5 represents OH, a protected OH, —O—P(═O)(OH)2, a sugar, H, a halogen, —CF3, a C1-C4 alkyl, a C2-C4 alkenyl or a C2-C4 alkynyl, R6 represents H, OH, protected OH, —O—P(═O)(OH)2, or a sugar, R7 represents H, OH, protected OH, a halogen, a C1-C4 alkyl, a C2-C4 alkenyl, a C2-C4 alkynyl, a triazolyl, —O—Rb, N(Rc)(Rd), —C(═O)—N(Re)(Rf), —O—C(═O)—N(Rg)(Rh), and R8, R9, R10, and R11 are, independently, H, OH or protected OH. The present invention further relates to the method of preparation thereof, the intermediates thereof and the therapeutic applications thereof.

Classes IPC  ?

• C07D 493/04 - Systèmes condensés en ortho
• A61K 31/352 - Composés hétérocycliques ayant l'oxygène comme seul hétéro-atome d'un cycle, p.ex. fungichromine ayant des cycles à six chaînons avec un oxygène comme seul hétéro-atome d'un cycle condensés avec des carbocycles, p.ex. cannabinols, méthanthéline

Abrégé

The food additive lauryl gallate (LG, E312) is a molecule with antioxidant and hydrophobic properties which has also been shown to exert antibacterial, antiviral and anti-tumoral effects. Here, the inventors show that LG at a low concentration has the ability to spontaneously induce washed human platelet shape change, filopodia emission, granule secretion, phosphatidylserine expression and aggregation. LG was able to activate intracellular signaling pathways including Akt, p38MAP-kinase and calcium response and to trigger activation of the αIIbβ3 integrin. LG also significantly potentiated platelet aggregation induced by low doses of collagen or thrombin receptor agonist peptide. Consistent with this, low doses of LG added to human blood promoted a strong platelet thrombotic response under arterial flow on a collagen matrix. As shown by electron microscopy, at a high concentration, LG induced a dramatic platelet membrane modification associated with calcium influx and a slow platelet aggregation response. Finally, a local flash-application of LG efficiently decreased the tail bleeding in rats suggesting that this compound has the potential to act as a hemostatic. Overall, the results indicate that the food additive LG, possibly through its capacity to modify membrane lateral organization, has pro-aggregant and antihemorrhagic properties.

Classes IPC  ?

• A61K 31/235 - Esters, p.ex. nitroglycérine, sélénocyanates d'acides carboxyliques ayant un noyau aromatique lié au groupe carboxyle
• A61K 47/10 - Alcools; Phénols; Leurs sels, p.ex. glycérol; Polyéthylène glycols [PEG]; Poloxamères; Alkyléthers de PEG/POE
• A61P 7/04 - Antihémorragiques; Profacteurs de coagulation; Agents hémostatiques; Agents antifibrinolytiques

Abrégé

LDLrLDLr -/-PPARαLDLrLDLr -/- PPARαPPARα +/+LDLrLDLr -/- PPARαPPARα -/-LDLrLDLr -/- PPARαPPARα +/+LDLrLDLr -/- PPARαPPARα +/+LDLrLDLr -/- PPARαPPARα +/+ mice. The present invenion defines a new relevant mouse model of progressive MASLD, developing all the characteristics of human MASLD (steatosis, inflammation, ballooning, fibrosis), in a relatively short time period (12-18 weeks), along with simultaneous atherosclerosis development.

Classes IPC  ?

• A01K 67/0276 - Vertébrés knock-out

Abrégé

A growing number of patients presenting severe combined immunodeficiencies associated with Rac2 mutations have been identified in newborns. These mutations are associated with high frequency of infection, leukopenia and more rarely autoinflammatory features. Here, the inventors show that the Rac2 activating mutations activates the NLRP3 inflammasome leading to the secretion of IL-1β from macrophages depending on the mutated RAC2 activation strength. Therefore, inhibiting the Rac2-PAK1/2-NLRP3 inflammasome pathway should be considered as a potential treatment for these patients. The present invention relates to a method of treating Rac2 monogenic disorders in a subject in need thereof comprising the administration of an inhibitor of NLRP3 and/or an inhibitor of PAK1/2 and/or an inhibitor of caspase 1.

Classes IPC  ?

• A61K 31/10 - Sulfures; Sulfoxydes; Sulfones
• A61K 31/197 - Acides carboxyliques, p.ex. acide valproïque ayant un groupe amino les groupes amino et carboxyle étant liés à la même chaîne carbone acyclique, p.ex. acide gamma-aminobutyrique (GABA), bêta-alanine, acide epsilon-aminocaproïque, acide pantothénique
• A61K 31/341 - Composés hétérocycliques ayant l'oxygène comme seul hétéro-atome d'un cycle, p.ex. fungichromine ayant des cycles à cinq chaînons avec un oxygène comme seul hétéro-atome d'un cycle, p.ex. isosorbide non condensés avec un autre cycle, p.ex. ranitidine, furosémide, bufétolol, muscarine
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p.ex. composés antiphlogistiques et pour le cœur 
• A61P 37/00 - Médicaments pour le traitement des troubles immunologiques ou allergiques
• A61K 31/095 - Composés du soufre, du sélénium ou du tellure, p.ex. thiols
• A61K 31/495 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p.ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec deux azote comme seuls hétéro-atomes d'un cycle, p.ex. pipérazine
• A61K 31/64 - Sulfonylurées, p.ex. glibenclamide, tolbutamide, chlorpropamide

Abrégé

A method for diagnosing a cancer in a subject, notably with the aim of finding fusion transcripts, includes an RT-MLPA step carried out on a biological sample obtained from the subject using the probes SEQ ID NO: 1 to 25, 30, 31 and 113 to 120, and/or with at least the probes SEQ ID NO: 374 to 405, and/or with at least the probes SEQ ID NO: 524 to 559, each of the probes being fused, at one end at least, with a priming sequence.

Classes IPC  ?

• C12Q 1/6886 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p.ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique pour le cancer

Abrégé

αα pp αα1pp1UU αα pp p )) of the soft tissue which depends on these parameters.

Classes IPC  ?

• G06T 7/35 - Détermination des paramètres de transformation pour l'alignement des images, c. à d. recalage des images utilisant des procédés statistiques

Abrégé

in vivoin vivo in a mouse model of transplant vasculopathy decreases transplant vasculopathy after aortic allograft. Accordingly, the present invention relates to a method of treating a subject at risk or suffering from transplant vasculopathy comprising administering to said subject a therapeutically effective amount of a CXCL10 inhibitor.

Classes IPC  ?

• A61K 38/13 - Cyclosporines
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p.ex. composés antiphlogistiques et pour le cœur 
• A61P 37/06 - Immunosuppresseurs, p.ex. médicaments pour le traitement du rejet de greffe
• A61K 39/00 - Préparations médicinales contenant des antigènes ou des anticorps
• C07K 16/24 - Immunoglobulines, p.ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des cytokines, des lymphokines ou des interférons

Abrégé

The tumor microenvironment (TME) is characterized by hostile conditions that lead to the induction of the unfolded protein response (UPR) in both cancer cells and immune infiltrating cells. Mechanistically, DPM1 KO leads to reduced production of key cytokines and cell surface expression of PD-L1 (a major player in the control of adaptive immune response) through ERAD (ER-associated protein degradation). Additionally, DPM1 KO in cancer cells limited M2-like macrophages polarization overcoming immunosuppression and enhances cytotoxic T cell activity. Thus, the inventors' work reveals how tumoral UPR can limit tumor growth and suggests that DPM1 inhibition is a useful strategy for improving cancer immunotherapy. The present invention relates to a method of treating cancer in a patient in need thereof comprising administering to the patient a therapeutically effective amount of a Dolichol-phosphate mannosyltransferase (DPM1) inhibitor.

Classes IPC  ?

• A61K 31/7105 - Acides ribonucléiques naturels, c. à d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester 
• A61K 31/00 - Préparations médicinales contenant des ingrédients actifs organiques 
• A61K 31/713 - Acides nucléiques ou oligonucléotides à structure en double-hélice
• A61K 39/00 - Préparations médicinales contenant des antigènes ou des anticorps
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p.ex. composés antiphlogistiques et pour le cœur 
• A61P 35/00 - Agents anticancéreux
• A61K 38/00 - Préparations médicinales contenant des peptides
• G01N 33/68 - Analyse chimique de matériau biologique, p.ex. de sang ou d'urine; Test par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligands; Test immunologique faisant intervenir des protéines, peptides ou amino-acides

Abrégé

Provided herein are methods and kits of using certain biomarkers in identifying subtypes of follicular lymphoma, selectively treating the subtypes of follicular lymphoma (FL), and identifying a subject who is likely to be responsive and predicting the responsiveness of a subject to a FL treatment.

Classes IPC  ?

• C07K 14/47 - Peptides ayant plus de 20 amino-acides; Gastrines; Somatostatines; Mélanotropines; Leurs dérivés provenant d'humains provenant de vertébrés provenant de mammifères
• A61P 35/00 - Agents anticancéreux
• C12Q 1/6886 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p.ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique pour le cancer

Abrégé

The invention relates to a method of producing CD34+CD41dim megakaryocyte (MK) progenitor cells, and a substantially pure cell population of megakaryocyte precursor cells obtained by said method and compositions thereof. The invention also relates to a method of producing proplatelet-bearing MKs and/or platelets using the CD34+CD41dim cells.

Classes IPC  ?

• C12N 5/078 - Cellules du sang ou du système immunitaire
• A61K 35/19 - Plaquettes; Mégacaryocytes

Abrégé

Functional imaging, in particular functional ultrasound imaging, is becoming a powerful tool for early detection of disorders such as neurodegenerative diseases. The present disclosure proposes a reliable method for such early detection, by delivering a stimulus to the nervous system, performing a functional imaging of an area of interest of the nervous system activated by the stimulus to obtain a series of hemodynamic Doppler images of the vascular network in the area of interest, and computing, from the series of hemodynamic Doppler images, a hemodynamic response (22) to the stimulus. The shape of hemodynamic response may be used to detect health disorders.

Classes IPC  ?

• A61B 8/08 - Détection de mouvements ou de changements organiques, p.ex. tumeurs, kystes, gonflements
• A61B 8/10 - Examen de l'œil

Abrégé

The invention relates to a measurement device for measuring weak magnetic fields, such as fields in the sub-picotesla range (e.g. lower than a few nanotesla). The measurement device comprises ultrasensitive magnetic sensors (or arrays of ultrasensitive magnetic sensors) coupled to low-noise processing circuitry. The processing circuitry comprises a two-stage design including low-noise amplifiers and analog filters. The invention is suitable for magnetocardiovascular (MCV) applications thanks to its ability to measure very small magnetic fields with good accuracy and very little noise.

Classes IPC  ?

• A61B 5/243 - Détection de champs biomagnétiques, p.ex. de champs magnétiques produits par des courants bioélectriques spécialement adaptée aux signaux magnétocardiographiques [MCG]
• A61B 5/00 - Mesure servant à établir un diagnostic ; Identification des individus
• G01N 27/82 - Recherche ou analyse des matériaux par l'emploi de moyens électriques, électrochimiques ou magnétiques en recherchant des variables magnétiques pour rechercher la présence des criques

Abrégé

Despite the presence of multiple disulphide bridges and the complicated tertiary structure of the venom peptide, the inventors in the present application showed that caging strategy involving covalent attachment of a photolabile protecting group on the lateral chain of a key residue for venom peptide activity causes steric clashes which are important enough to reduce the ion channel modulation efficacy. The inventors showed that the photoactivatable venom peptide which presents a shift of at least 100-fold of the dose-response value of normalized ion channel current in comparison to wild-type venom peptide is required to be effective under physiological conditions. The inventors showed for the first time that the chemical and photosensitive properties conferred to toxins allowed to probe the role of ion channel function in vivo with high spatial resolution making its therapeutic use possible. As further shown by the inventors, the technique can be generalized to toxins possessing more or less ion channel selectivity and is applicable to both inhibitors and activators. The present disclosure relates to a photoactivatable ion channel modulator, in particular for use in the treatment of an ion channel-related disease wherein said photoactivatable ion channel modulator is a disulphide-rich venom peptide comprising a photolabile protecting group.

Classes IPC  ?

• C07K 14/435 - Peptides ayant plus de 20 amino-acides; Gastrines; Somatostatines; Mélanotropines; Leurs dérivés provenant d'humains
• A61K 38/00 - Préparations médicinales contenant des peptides

Abrégé

The present invention relates to a virus-derived particle comprising one or more Cas protein(s), as well as to kits and methods using the same for altering a target nucleic acid.

Classes IPC  ?

• C07K 14/005 - Peptides ayant plus de 20 amino-acides; Gastrines; Somatostatines; Mélanotropines; Leurs dérivés provenant de virus
• C12N 7/00 - Virus, p.ex. bactériophages; Compositions les contenant; Leur préparation ou purification
• C12N 9/22 - Ribonucléases
• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p.ex. oligonucléotides anti-sens

Abrégé

The inventors have now succeeded in developing modified lipid oligonucleotides. These compounds have the advantage of spontaneously self-assembling and switching from the conventional antiparallel aptameric fold at low ionic strength to the parallel, inactive, conformation of the oligonucleotide strands, in particular TBA oligonucleotide strands, in physiologically relevant conditions. The latter parallel conformation can be readily and chemo-selectively switched back to the anti-parallel native aptamer conformation upon light irradiation. Such modified lipid oligonucleotides are thus of particular interest to improve the pharmacodynamical profile of the unmodified oligonucleotides. The present invention thus relates to modified lipid oligonucleotides comprising a photocleavable linker and their use in medical treatments, in particular treatments involving antiproliferative activity against cancer cells, anticoagulant activity, antiviral activity or activity against heart failure.

Classes IPC  ?

• C07H 21/00 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p.ex. acides nucléiques
• C12N 9/96 - Stabilisation d'une enzyme par formation d'un adduct ou d'une composition; Formation de conjugaisons d'enzymes
• C12N 15/115 - Aptamères, c. à d. acides nucléiques liant spécifiquement une molécule cible avec une haute affinité sans s'y hybrider
• C12Q 1/37 - Procédés de mesure ou de test faisant intervenir des enzymes, des acides nucléiques ou des micro-organismes; Compositions à cet effet; Procédés pour préparer ces compositions faisant intervenir une hydrolase faisant intervenir une peptidase ou une protéinase
• C07H 21/04 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p.ex. acides nucléiques avec le désoxyribosyle comme radical saccharide

Abrégé

The present invention relates to a new drug conjugate comprising a CTLA4 targeting molecule, at least one cytotoxic agent, and a linker connecting the CTLA4 targeting molecule and the cytotoxic agent, as well as to compositions and kits comprising such a drug conjugate, and to uses thereof in particular for treating cancer and/or for preventing a cancer relapse in a subject in need thereof.

Classes IPC  ?

• A61K 47/68 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p.ex. les supports ou les additifs inertes; Agents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p.ex. conjugués polymère-médicament l’ingrédient non actif étant un agent de modification l’agent de modification étant un anticorps, une immunoglobuline ou son fragment, p.ex. un fragment Fc
• A61P 35/00 - Agents anticancéreux
• C07K 16/28 - Immunoglobulines, p.ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire
• A61K 39/00 - Préparations médicinales contenant des antigènes ou des anticorps

Abrégé

The invention relates to novel compositions, combinations and methods relating to compounds which inhibit EZH2 and their uses for treating and/or preventing tumors associated with methyltransferase EZH2. More specifically the invention relates to synergistic bi-therapy compositions for use in a method of treating and/or preventing tumors associated with methyltransferase EZH2, comprising administering to a subject in need, a therapeutically effective amount of the composition, wherein said composition comprises the combination of EZH2 inhibitor and one HMG-COA reductase inhibitor or statin. The present invention also relates to synergistic tri-therapy compositions as well as methods of use thereof for treating and/or preventing specific types of cancers and tumors comprising further administering an effective amount of one or more anti cancer drugs or chemotherapeutic agents in combination with the above bi-therapy compositions.

Classes IPC  ?

• A61K 31/496 - Pipérazines non condensées contenant d'autres hétérocycles, p.ex. rifampine, thiothixène
• A61K 31/282 - Composés du platine
• A61K 31/366 - Lactones ayant des cycles à six chaînons, p.ex. delta-lactones
• A61K 31/40 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p.ex. guanéthidine ou rifamycines ayant des cycles à cinq chaînons avec un azote comme seul hétéro-atome d'un cycle, p.ex. sulpiride, succinimide, tolmétine, buflomédil
• A61K 31/5377 - 1,4-Oxazines, p.ex. morpholine non condensées et contenant d'autres hétérocycles, p.ex. timolol
• A61K 33/243 - Platine; Ses composés
• A61P 35/00 - Agents anticancéreux

Abrégé

The invention relates to a method for detecting a change in a patient's physiological condition with respect to a reference physiological condition. The method is based on a multimodal analysis that involves measurements of electroencephalography signals Si from the patient and at least one other physiological signal SN+1(N≥1) from the patient. Based on these measurements, the invention proposes calculating distances di(m) associated with the electroencephalography measurements and with the measurements of the other physiological signals and fusing these data, the data having previously undergone a certain number of mathematical processing operations. In the context of the invention, the fused data may be assigned a weighting coefficient chosen according to one or more a priori or a posteriori criteria.

Classes IPC  ?

• G16H 50/30 - TIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicales; TIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour l’évaluation des risques pour la santé d’une personne
• A61B 5/00 - Mesure servant à établir un diagnostic ; Identification des individus
• A61B 5/31 - Circuits d’entrée à cet effet spécialement adaptés à des utilisations particulières pour l’électroencéphalographie [EEG]
• A61B 5/369 - Modalités, c. à d. méthodes diagnostiques spécifiques Électroencéphalographie [EEG]
• G16H 40/63 - TIC spécialement adaptées à la gestion ou à l’administration de ressources ou d’établissements de santé; TIC spécialement adaptées à la gestion ou au fonctionnement d’équipement ou de dispositifs médicaux pour le fonctionnement d’équipement ou de dispositifs médicaux pour le fonctionnement local

Abrégé

A method for obtaining an irradiation map of a patient during interventional radiology, comprising: a learning phase consisting in submitting to a neural network a learning set comprising associations between a first input tensor comprising data of a first radiology image of a patient's intervention area, and first acquisition parameters of an interventional radiology device, and labels corresponding to an irradiation map obtained by simulation from the said first radiology image and the said first acquisition parameters, a prediction phase on a given patient, comprising the acquisition of a stream of second acquisition parameters of said interventional radiology device, the preparation of a second input tensor comprising data of a second radiology image of said given patient and of said second acquisition parameters, the submission of said second input vector to said neural network and the retrieval of an irradiation map prediction.

Classes IPC  ?

• A61N 5/10 - Radiothérapie; Traitement aux rayons gamma; Traitement par irradiation de particules

Abrégé

The present invention concerns a method of producing brown/beige adipocytes from white adipose tissue cells and/or mesenchymal stem cells, in particular from subcutaneous white adipose tissue cells, and the use of said brown/beige adipocytes in a cell based therapy of a subject or in screening platforms.

Classes IPC  ?

• C12N 5/077 - Cellules mésenchymateuses, p.ex. cellules osseuses, cellules de cartilage, cellules stromales médulaires, cellules adipeuses ou cellules musculaires
• A61K 35/35 - Tissu graisseux; Adipocytes; Cellules stromales; Tissus conjonctifs
• C12N 5/0775 - Cellules souches mésenchymateuses; Cellules souches dérivées du tissu adipeux
• G01N 33/50 - Analyse chimique de matériau biologique, p.ex. de sang ou d'urine; Test par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligands; Test immunologique

Abrégé

The Inventors developed conditions allowing to efficiently detect differences in cardiomyocytes relaxation phases associated with increased cardiomyocytes stiffness. They used a library of patient-specific human induced pluripotent stem cells (hiPSC) either from healthy donors or carrying mutations (i.e., MYH7 and BRAF mutations) associated with hypertrophic cardiomyopathy, a condition typically associated with impaired diastolic function as well as an increase in cardiomyocytes passive stiffness. They performed a high throughput screening on hiPSC-derived cardiac cells to identify microRNAs capable of modifying the relaxation rates of cardiomyocytes. In particular, they set up a large-scale functional genomics using miRNAs screening. All identified miRNAs were tested for their impact on cardiac cells movement and calcium transient. miRNAs with the highest impact were in particular tested on ECTs and changes in diastolic function, were measured and compared to the results obtained at the cell level. They manipulated the most interesting ‘hits’ in 3D models using similar readouts as in primary assays. They tested the impact of the positive ‘hits’ in mechanical models (developed during the exploratory part) and establish physiological and biochemical mechanisms of action of the identified key proteins. They finally identified two promising miRNAs that could be used for improving striated myocytes relaxation and, more generally, to alleviate symptoms related to striated muscle stiffness, in particular in the context of heart failure with a preserved ejection fraction (HFpEF).

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p.ex. oligonucléotides anti-sens

Abrégé

The present invention relates to nitrogen-containing derivatives of salinomycin having the formula (I), as well as pharmaceutically acceptable salt thereof, and synthesis and uses thereof, in particular for the treatment and/or prevention of cancer including for preventing cancer metastasis and/or for preventing cancer recurrence and/or for decreasing resistance to a chemotherapy in a subject.

Classes IPC  ?

• C07D 493/20 - Systèmes condensés en spiro
• A61K 31/35 - Composés hétérocycliques ayant l'oxygène comme seul hétéro-atome d'un cycle, p.ex. fungichromine ayant des cycles à six chaînons avec un oxygène comme seul hétéro-atome d'un cycle
• A61P 35/00 - Agents anticancéreux

Abrégé

Cholesterol efflux pathways have anti-inflammatory and anti-proliferative properties that could be exploited in tumor biology to unravel cancer vulnerabilities. Using a mouse model of lungtumor bearing KRASG12D mutation, the inventors identified that disruption of cholesterol efflux pathways by specific inactivation of Abca1 and Abcg1 in epithelial cancer progenitor cells and to some extent in macrophages promoted a pro-tolerogenic tumor microenvironment (TME). In particular, the inventors show that cholesterol removal therapy with cyclodextrin inhalation also reduced tumor burden in progressing tumor by suppressing the proliferation and expansion of epithelial progenitor cells of tumor-origin. The inventors' results position cholesterol removal therapy as a putative metabolic target in lung cancer progenitor cells. The present invention relates to a method for the treatment of a lung cancer in a patient in need thereof comprising administering to the patient a therapeutically effective amount of cyclodextrin.

Classes IPC  ?

• A61K 31/724 - Cyclodextrines
• A61P 35/00 - Agents anticancéreux
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p.ex. composés antiphlogistiques et pour le cœur 

Abrégé

The present invention relates to a method for assessing the risk of Chronic Lung Allograft Dysfunction (CLAD) in a lung transplanted subject, comprising determining a risk score based on biological and clinical parameters. The present invention further relates to a method for preventing CLAD occurrence in a subject, comprising determining the personalized course of treatment for the subject based on the obtained risk score.

Classes IPC  ?

• G01N 33/68 - Analyse chimique de matériau biologique, p.ex. de sang ou d'urine; Test par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligands; Test immunologique faisant intervenir des protéines, peptides ou amino-acides

Abrégé

The invention relates to a method implemented by computer means for determining the influence of a plurality of regions in a medical image (I) of a patient on a prediction of a pretrained prediction model (PM) based on said image (I), comprising: (a) determining image features (F1, F2, F3) of a plurality of regions (A1, A2, A3) on said image (I), (b) transforming said features (F1, F2, F3) of each region (A1, A2, A3) in an aggregated tensor (F) inputted into said pretrained prediction model, (c) calculating, based on said features, the Shapley value of each region, said Shapley value representing the influence of said region on said prediction.

Classes IPC  ?

• G06T 7/00 - Analyse d'image
• G06N 3/00 - Agencements informatiques fondés sur des modèles biologiques
• G06N 20/10 - Apprentissage automatique utilisant des méthodes à noyaux, p.ex. séparateurs à vaste marge [SVM]
• G06N 20/20 - Techniques d’ensemble en apprentissage automatique
• G06N 3/0464 - Réseaux convolutifs [CNN, ConvNet]
• G06N 5/01 - Techniques de recherche dynamique; Heuristiques; Arbres dynamiques; Séparation et évaluation

Abrégé

The deep brain stimulation system has at least four stimulation pairs of electrodes. Each stimulation pair of electrodes provides an electric stimulation at a carrier frequency. The mean value between the carrier frequency of any first stimulation pair of electrodes and the carrier frequency of any second stimulation pair of electrodes defines a first mean carrier frequency. The mean value between the carrier frequency of any third stimulation pair of electrodes and the carrier frequency of any fourth stimulation pair of electrodes defines a second mean carrier frequency. The difference between the first and second mean carrier frequencies is equal to or greater than 200 Hz.

Classes IPC  ?

• A61N 1/32 - Application de courants électriques par électrodes de contact courants alternatifs ou intermittents
• A61N 1/04 - Electrodes
• A61N 1/05 - Electrodes à implanter ou à introduire dans le corps, p.ex. électrode cardiaque
• A61N 1/36 - Application de courants électriques par électrodes de contact courants alternatifs ou intermittents pour stimuler, p.ex. stimulateurs cardiaques

Abrégé

Investigating the impact of BTG1 inactivation in lymphoma, the Inventors have demonstrated its role as a driver of lymphomagenesis in a murine model. They have also described the phenotypic consequences of BTG1 inactivation in human lymphoma cell lines. Especially, they have demonstrated that the inactivation of BTG1 is associated with an increased sensitivity to MCL-1 inhibition, which paves the way to the development of a personalized treatment for patients with BTG1 mutated lymphomas and cancers with a BTG1 inactivation. Accordingly, in a first aspect, the present invention relates to a method for predicting the response to a MCL-1 inhibitor treatment in a patient suffering from a cancer with a BTG1 inactivation, comprising the step of determining in a biological sample obtained from said patient the BTG1 mutation status, wherein a BTG1 inactivation is predictive of a response to a MCL-1 inhibitor treatment. In a second aspect, the present invention relates to a method of treating a patient suffering from a cancer with a BTG1 inactivation comprising the step of determining the BTG1 mutation status and administering a therapeutically effective amount of MCL-1 inhibitor when the patient carries a BTG1 gene inactivation.

Classes IPC  ?

• C12Q 1/6886 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p.ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique pour le cancer

Abrégé

The inventors report in the present application the results of applying this innovative analytical approach on three independent EWASs for deriving and validating an epigenome score that exhibited a high diagnostic accuracy for detecting hepatocellular carcinoma (HCC). Indeed, they have performed in silico replication studies on two independent DNA methylome datasets using the 105 CpG probes of the HCC Epigenome Score. All the 13 loci were significantly associated with the HCC phenotype in both replication studies. Consistently, the random effect meta-analysis confirmed the significance of the 13 top loci. The inventors performed dose-response probit regression analysis to assess the association between the HCC Epigenome Score using the 586 samples. The HCC Epigenome score was significantly associated with the risk of HCC with a gradual increase in the risk of HCC according to the increase in the HCC Epigenome Score. Accordingly, the present invention relates to the use of a DNA methylation signature for diagnosing hepatocellular carcinoma in a subject.

Classes IPC  ?

• C12Q 1/6886 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p.ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique pour le cancer

Abrégé

Metastatic uveal melanomas are highly resistant to all existing treatments. Here, a kinome-wide CRISPR-Cas9 knockout screen, revealed that the LKB1-SIK2 module plays a critical role in constraining uveal melanoma cell tumorigenesis. The inventors' results demonstrate that a combination of SLC8A1 inhibitor and mitochondria-targeted antioxidant has an enhanced cell death efficacy in LKB1 and SIK2-negative uveal melanoma cells. They also designed a LKB1 loss gene signature that is predictive of patient survival and treatment response. Their data thus identify new prognosis markers, and metabolic vulnerability, thereby providing a therapeutic strategy for these subtypes of metastatic uveal melanomas. The present invention relates to a method for treating melanoma in a subject in need thereof comprising a step of administering said subject with a therapeutically effective amount of a combination of SLC8A1 inhibitor and mitochondria-targeted antioxidant.

Classes IPC  ?

• A61K 31/155 - Amidines (), p.ex. guanidine (H2N-C(=NH)-NH2), isourée (HN=C(OH)NH2), isothiourée (HN=C(SH)-NH2)
• A61K 31/66 - Composés du phosphore
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p.ex. composés antiphlogistiques et pour le cœur 
• A61P 35/00 - Agents anticancéreux
• G01N 33/50 - Analyse chimique de matériau biologique, p.ex. de sang ou d'urine; Test par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligands; Test immunologique

Abrégé

The present invention relates to the treatment of focal cortical dysplasia. In this study, the inventors showed that GluK2-containing kainate receptors (KARs) play a key role in epileptiform activities in neocortex in an animal model of type II FCD (FCDII) demonstrating that KARs can constitute a major antiepileptic target to treat chronic epilepsy in FCD. Thus, the present invention relates to an inhibitor of GluK2-containing kainate receptors (KAR) for use in the treatment of focal cortical dysplasia (FCD) in a subject in need thereof.

Classes IPC  ?

• A61K 31/513 - Pyrimidines; Pyrimidines hydrogénées, p.ex. triméthoprime ayant des groupes oxo liés directement à l'hétérocycle, p.ex. cytosine
• A61K 45/00 - Préparations médicinales contenant des ingrédients actifs non prévus dans les groupes
• A61P 25/00 - Médicaments pour le traitement des troubles du système nerveux

Abrégé

The present invention relates to a method of evaluating the sensitivity or resistance of a cancer cell to an antitumoral therapeutic treatment. It further relates to the treatment of a cancer with an inhibitor of the eiF4F complex used for the sensitisation of said cancer to an antitumoral therapeutic treatment.

Classes IPC  ?

• G01N 33/574 - Tests immunologiques; Tests faisant intervenir la formation de liaisons biospécifiques; Matériaux à cet effet pour le cancer
• A61K 31/357 - Composés hétérocycliques ayant l'oxygène comme seul hétéro-atome d'un cycle, p.ex. fungichromine ayant plusieurs atomes d'oxygène dans le même cycle, p.ex. éthers en couronne, guanadrel
• A61K 31/58 - Composés contenant des systèmes cycliques du cyclopenta[a]hydrophénanthrène; Leurs dérivés, p.ex. stéroïdes contenant des hétérocycles, p.ex. danazol, stanozolol, pancuronium ou digitogénine
• G01N 33/68 - Analyse chimique de matériau biologique, p.ex. de sang ou d'urine; Test par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligands; Test immunologique faisant intervenir des protéines, peptides ou amino-acides

Abrégé

Stroke is the second cause of death and the first cause of adult disability in industrialized countries. The goal of emergency therapy for acute ischemic stroke is prompt restoration of blood flow to regions of brain that are ischemic but not yet infarcted. Based on this, the inventors compare the plasma concentration of total tPA (antigenic: active + PAI-1 bound) in patients with acute ischemic stroke before any treatment with those in a healthy control group, to evaluate the interest of tPA as a potential diagnostic biomarker in the acute phase of ischemic stroke. In particular, the present invention relates to method for discriminating at early stage an hemorrhagic stroke from an ischemic stroke or a mimic stroke in a subject in need thereof, comprising the steps of i) determining in a blood sample obtained from the said subject the level of tissue-type plasminogen activator (tPA), ii) comparing the level determined in step i) with a reference value and iii) concluding when the level of tissue-type plasminogen activator (tPA) determined at step i) is higher than the reference value is predictive of a risk of having or developing an ischemic stroke or a mimic stroke or concluding when the level of tissue-type plasminogen activator (tPA) determined at step i) is lower than the reference value is predictive of a risk of having or developing a hemorrhagic stroke

Classes IPC  ?

• G01N 33/68 - Analyse chimique de matériau biologique, p.ex. de sang ou d'urine; Test par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligands; Test immunologique faisant intervenir des protéines, peptides ou amino-acides

Abrégé

A method for studying the behaviour of a cell sample contained in a medium containing a plurality of anisotropically shaped nanoparticles dispersed therein, the method including: (i) determining at least one nanoparticle orientation characteristic in a measurement zone at the interface between the fluid medium and the cell sample, the orientation resulting at least partially from the interaction of the fluid medium and the biological material; (ii) determining a mean shear rate characteristic of the fluid medium in the measurement zone from said at least one nanoparticle orientation characteristic determined in this measurement zone; and (iii) determining a characteristic of the cell sample from the mean shear rate thus determined in the measurement zone.

Classes IPC  ?

• G01N 33/50 - Analyse chimique de matériau biologique, p.ex. de sang ou d'urine; Test par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligands; Test immunologique
• C12M 1/34 - Mesure ou test par des moyens de mesure ou de détection des conditions du milieu, p.ex. par des compteurs de colonies
• C12M 3/06 - Appareillage pour la culture de tissus, de cellules humaines, animales ou végétales, ou de virus avec des moyens de filtration, d'ultrafiltration, d'osmose inverse ou de dialyse
• G01N 21/64 - Fluorescence; Phosphorescence

Abrégé

Provided are closed systems methods of use for isolation of mammalian tissues.

Classes IPC  ?

• C12N 5/071 - Cellules ou tissus de vertébrés, p.ex. cellules humaines ou tissus humains

Abrégé

wherein said tumor neoantigenic peptide binds to at least one Major Histocompatibility Complex (MHC) molecule of said subject. The present disclosure also relates to tumor neoantigenic peptide obtained according to the present method, vaccine or immunogenic composition, antibodies and immune cells derived thereof and their use in therapy of cancer.

Classes IPC  ?

• C07K 16/28 - Immunoglobulines, p.ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire
• C07K 14/74 - Complexe majeur d'histocompatibilité (MHC)
• C12N 5/078 - Cellules du sang ou du système immunitaire

Abrégé

Anaplastic large cell lymphoma (ALCL) is a rare and aggressive peripheral T-cell lymphoma affects lymph nodes and extra-nodal sites with characteristic skin lesions. Approximatively half of the tumors express the NPM1-ALK fusion from the translocation t(2;5)(p23;q32). In the present study, the inventors identify ROR2 as progressively up regulated thought tumorigenesis. Patient samples show a significantly high ROR2 expression (transcriptomic data) as well as a strong ROR2 protein expression (IHC) with some tumors displaying a clear membrane signal. ROR2 mRNA expression level is also positively correlated to NPM-ALK expression level in tumor cells and is not expressed in normal T cells. In addition, ROR2 protein level is significantly increased in resistant cells to the ALK inhibitor, crizotinib, used in clinical trials for children with refractory tumors. This result opens the road to ROR2 specific therapies: ROR2 inhibitors, monoclonal antibodies therapies or even ROR2 specific CAR cells, including for ALCL ALK(+) resistant tumors.

Classes IPC  ?

• A61K 39/00 - Préparations médicinales contenant des antigènes ou des anticorps
• C07K 14/725 - Récepteurs de lymphocytes-T
• C07K 16/28 - Immunoglobulines, p.ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire

Abrégé

The present invention relates to recombinant variants of R-spondin proteins and their use as a medicament, in particular for the treatment of diabetes.

Classes IPC  ?

• C07K 14/47 - Peptides ayant plus de 20 amino-acides; Gastrines; Somatostatines; Mélanotropines; Leurs dérivés provenant d'humains provenant de vertébrés provenant de mammifères
• A61K 38/00 - Préparations médicinales contenant des peptides
• A61P 3/10 - Médicaments pour le traitement des troubles du métabolisme de l'homéostase du glucose de l'hyperglycémie, p.ex. antidiabétiques

Abrégé

The present invention relates to a composition comprising a β-cyclodextrin polymer (a); and at least one compound (b) selected from mycolactone and derivatives thereof.

Classes IPC  ?

• A61K 47/69 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p.ex. les supports ou les additifs inertes; Agents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p.ex. conjugués polymère-médicament le conjugué étant caractérisé par sa forme physique ou sa forme galénique, p.ex. émulsion, particule, complexe d’inclusion, stent ou kit
• A61P 29/00 - Agents analgésiques, antipyrétiques ou anti-inflammatoires non centraux, p.ex. agents antirhumatismaux; Médicaments anti-inflammatoires non stéroïdiens [AINS]
• A61K 9/00 - Préparations médicinales caractérisées par un aspect particulier

Abrégé

The present invention relates the stratification and treatment of patient suffering from a cancer. In this study, the inventors analyzed the adenosine methylation level of miR-125a-5p (m6A-miR-125a-5p) using RNA immunoprecipitation with an anti-methyl-base-antibody followed by qPCR. CLIP and ELISA were used to study the effect of m6A-miR-125a-5p on its ability to be recruited on GW182 and impact PD-1 expression, respectively. They showed that the METTL3-mediated m6A-miR-125a-5p regulates the expression of IGSF11/VSIG3 which acts as a molecular determinant of the immunogenicity of tumor cells. Observations in two lung cancer patients treated with anti-PD-1 therapy show that the m6A-miR-125a-5p level is analyzable from EVs/exosomes from longitudinal blood samples. These data provide that m6A- miR-125a-5p level can be used as a biomarker and therapeutic solutions (anti-IGSF11 antibody and METTL3 inhibitor) could potentially address the anti-PD1 therapy failure in a context of precision and personalized medicine intended for the right patient, at the right time, with the right therapy. Thus the invention relates to a method of identifying a patient having or at risk of having or developing a resistance to anti-PD-1 therapy based on the expression level of the extracellular vesicles adenosine methylated miR-125a-5p (m6A-miR-125a-5p).

Classes IPC  ?

• C12Q 1/6886 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p.ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique pour le cancer

Abrégé

LdlrLdlrLdlr/" females; 2) potently decreases the size of aortic atherosclerotic lesions. These preliminary data support the hypothesis of a beneficial role of LIPC E97G towards the development of atherosclerosis and reinforce the need for further studies. Interestingly, they also open the prospect of new therapeutic solutions in familial hypercholesterolemia (EH) patients with partial/total EDER deficiency. The present invention relates to a method for treating hypercholesterolemia, including homozygous and heterozygous EH, and related ASCVD in a subject in need thereof comprising administering a therapeutically effective amount of a LIPC variant to said subject in need thereof.

Classes IPC  ?

• A61K 38/46 - Hydrolases (3)
• A61K 31/7088 - Composés ayant au moins trois nucléosides ou nucléotides
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiques; Thérapie génique
• C07K 14/435 - Peptides ayant plus de 20 amino-acides; Gastrines; Somatostatines; Mélanotropines; Leurs dérivés provenant d'humains
• A61P 3/06 - Antihyperlipémiants
• A61P 9/00 - Médicaments pour le traitement des troubles du système cardiovasculaire
• C12N 15/86 - Vecteurs viraux

Abrégé

1163626163632344 independently represent a hydrogen atom or a halogen atom. It further relates to such a compound for its use as a medicament, and in particular for its use in treating and/or prevention of cancer, in particular cancer exhibiting recruitment of MDM2 to chromatin, more particularly selected from the group consisting of bone cancer, brain cancer, ovary cancer, breast cancer, lung cancer, colorectal cancer, osteosarcoma, skin cancer, blood cancer, including acute myeloid leukemia, pancreatic cancer, prostate cancer and liposarcoma and even more particularly selected from the group consisting of skin cancer, blood cancer, for example but not limited to acute myeloid leukemia, melanoma and liposarcoma.

Classes IPC  ?

• A61P 35/00 - Agents anticancéreux
• C07D 471/14 - Systèmes condensés en ortho
• C07D 519/00 - Composés hétérocycliques contenant plusieurs systèmes de plusieurs hétérocycles déterminants condensés entre eux ou condensés avec un système carbocyclique commun non prévus dans les groupes ou
• A61K 31/437 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p.ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle condensés en ortho ou en péri avec des systèmes hétérocycliques le système hétérocyclique contenant un cycle à cinq chaînons ayant l'azote comme hétéro-atome du cycle, p.ex. indolizine, bêta-carboline
• A61K 31/4375 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p.ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle condensés en ortho ou en péri avec des systèmes hétérocycliques le système hétérocyclique contenant un cycle à six chaînons ayant l'azote comme hétéro-atome du cycle, p.ex. quinolizines, naphtyridines, berbérine, vincamine
• A61K 31/4985 - Pyrazines ou pipérazines condensées en ortho ou en péri avec des systèmes hétérocycliques
• A61K 31/4709 - Quinoléines non condensées contenant d'autres hétérocycles
• A61K 31/4725 - Isoquinoléines non condensées, p.ex. papavérine contenant d'autres hétérocycles

Abrégé

The CRISPR-Cas9 system has revolutionized our ability to precisely modify the genome and has impelled gene editing into clinical applications. Comprehensive analysis of gene editing products at the targeted cut-site revealed a complex spectrum of outcomes. ON-target genotoxicity is underestimated with standard PCR-based methods and necessitates appropriate and sensitive detection methods. Here, the inventors developed two complementary Fluorescence-Assisted Megabase-scale Rearrangements Detection (FAMReD) systems that enable detection, quantification, and cell sorting of edited cells with megabase-scale loss of heterozygosity (LOH). They revealed rare complex chromosomal rearrangements caused by Cas9-nuclease and showed that LOH frequency depends on cell division rate during editing and p53 status. Cell cycle arrest during editing suppressed the appearance of LOH without compromising editing. These data were confirmed in human stem/progenitor cells, suggesting that clinical trials should consider p53 status and cell proliferation rate during editing to limit this risk and design safer protocols.

Classes IPC  ?

• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN
• C12N 15/90 - Introduction stable d'ADN étranger dans le chromosome

Abrégé

The disclosure relates to a method of treating cancer in a subject in need thereof, said method comprising (i) a priming phase, and (ii) a treatment phase, wherein said priming phase comprises administering an efficient amount of said nanoparticles in combination with a low-dose radiotherapy, and said treatment phase comprises administering an efficient amount of said nanoparticles in combination with radiotherapy, optionally in combination with an immune checkpoint blocker, wherein said nanoparticles are nanoparticles containing an element with an atomic Z number higher than 20, preferably higher than 50, for example between 40 and 83, more preferably gadolinium or bismuth.

Classes IPC  ?

• A61K 41/00 - Préparations médicinales obtenues par traitement de substances par énergie ondulatoire ou par rayonnement corpusculaire
• A61K 47/69 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p.ex. les supports ou les additifs inertes; Agents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p.ex. conjugués polymère-médicament le conjugué étant caractérisé par sa forme physique ou sa forme galénique, p.ex. émulsion, particule, complexe d’inclusion, stent ou kit
• A61P 35/00 - Agents anticancéreux
• A61K 103/34 - Gadolinium

Abrégé

The inventors generated a new anti-Cath-D antibody (F1M1) which is able to reduce tumor growth without apparent toxicity in strongly immune-infiltrated Cath-D-secreting basal-like TNBC cell lines. F1M1 antibody prevented the recruitment of immunosuppressive M2- polarized tumor-associated macrophages (TAMs), and induced natural killer cell activation in tumors, F1M1 also enhanced the activation of anti -tumor M1 -polarized TAMs, the recruitment and maturation of conventional cDC1 dendritic cells in tumors to promote antigen presentation, and reduced the expression of exhaustion markers on CD4+and CD8+T cells in tumors and draining lymph nodes. Interestingly, the antibody F1M1 exhibit also a better affinity to Cath-D than the antibody F1 previously generated by the inventors. The inventors also generated a novel Fc-optimized F1M 1-Fc+human antibody that promotes ADCC induction on both cancer cells and CAF, improves antitumor potency, and triggers NK cell recruitment, activation and cytotoxic activity in tumors. F1M1-Fc+F1M1-Fc+inhibited growth of MDA-MB-231 and SUM159 TNBC cell xenografts, and of two TNBC-PDX (one resistant to neoadjuvant chemotherapy) without apparent toxicity. Moreover, this F1M1-Fc+ improves paclitaxel and enzalutamide therapeutic efficacy in combination. Thus, the present invention relates to anti- cathepsin-D antibodies and their use in the treatment of cancers, particularly of triple negative breast cancer.

Classes IPC  ?

• C07K 16/40 - Immunoglobulines, p.ex. anticorps monoclonaux ou polyclonaux contre des enzymes
• C07K 16/30 - Immunoglobulines, p.ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire provenant de cellules de tumeurs
• A61K 39/395 - Anticorps; Immunoglobulines; Immunsérum, p.ex. sérum antilymphocitaire
• A61P 35/00 - Agents anticancéreux
• A61K 31/337 - Composés hétérocycliques ayant l'oxygène comme seul hétéro-atome d'un cycle, p.ex. fungichromine ayant des cycles à quatre chaînons, p.ex. taxol
• A61K 31/4166 - 1,3-Diazoles ayant des groupes oxo liés directement à l'hétérocycle, p.ex. phénytoïne

Abrégé

The present invention belongs to the field of medicine, and more precisely to the field of medicine useful in the treatment of cardiac diseases with contributing mitochondrial dysfunction. The present invention belongs to the field of medicine, and more precisely to the field of medicine useful in the treatment of cardiac diseases with contributing mitochondrial dysfunction. The present invention relates to a composition a pharmaceutical composition comprising a PPAR-modulator and an urolithin derivative of formula I: The present invention belongs to the field of medicine, and more precisely to the field of medicine useful in the treatment of cardiac diseases with contributing mitochondrial dysfunction. The present invention relates to a composition a pharmaceutical composition comprising a PPAR-modulator and an urolithin derivative of formula I: The present invention belongs to the field of medicine, and more precisely to the field of medicine useful in the treatment of cardiac diseases with contributing mitochondrial dysfunction. The present invention relates to a composition a pharmaceutical composition comprising a PPAR-modulator and an urolithin derivative of formula I: wherein R1, R2 and R3 independently represents H or OH and its use thereof in the treatment of various cardiac diseases linked to cardiac diseases with contributing mitochondrial dysfunction.

Classes IPC  ?

• A61K 31/37 - Coumarines, p.ex. psoralène
• A61K 31/195 - Acides carboxyliques, p.ex. acide valproïque ayant un groupe amino
• A61K 31/216 - Esters, p.ex. nitroglycérine, sélénocyanates d'acides carboxyliques d'acides ayant des cycles aromatiques, p.ex. bénactizyne, clofibrate
• A61P 9/00 - Médicaments pour le traitement des troubles du système cardiovasculaire

Abrégé

The invention relates to a method for the early in vitro diagnosis of a neurodegenerative disease in a human or an animal subject, the method comprising the step of detecting the presence of at least one marker chosen from among forms derived from amyloid beta peptides (Aβ) chosen from among the oligomers of these peptides and the prefibrillar and fibrillar aggregate forms of these peptides, and forms derived from phosphorylated tau proteins chosen from among the hyperphosphorylated forms of these proteins, the aggregate forms of these proteins and the modified phosphorylated tau proteins resulting from one or more post-translational modifications, the presence of the one or more markers being detected in a stool sample from this subject.

Classes IPC  ?

• G01N 33/68 - Analyse chimique de matériau biologique, p.ex. de sang ou d'urine; Test par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligands; Test immunologique faisant intervenir des protéines, peptides ou amino-acides

Abrégé

The present disclosure provides a method for identifying modulators of protein secretion. Also provided are modulators of protein secretion and use thereof.

Classes IPC  ?

• C12P 17/18 - Préparation de composés hétérocycliques comportant O, N, S, Se ou Te comme uniques hétéro-atomes du cycle contenant plusieurs hétérocycles condensés entre eux ou condensés avec un système carbocyclique commun, p.ex. rifamycine
• C12P 21/02 - Préparation de peptides ou de protéines comportant une séquence connue de plusieurs amino-acides, p.ex. glutathion
• C07K 16/00 - Immunoglobulines, p.ex. anticorps monoclonaux ou polyclonaux
• G01N 33/00 - Recherche ou analyse des matériaux par des méthodes spécifiques non couvertes par les groupes
• C12P 21/00 - Préparation de peptides ou de protéines
• C12N 5/00 - Cellules non différenciées humaines, animales ou végétales, p.ex. lignées cellulaires; Tissus; Leur culture ou conservation; Milieux de culture à cet effet

Abrégé

The present invention relates to novel serotonin derivatives of formula (I): The present invention relates to novel serotonin derivatives of formula (I): The present invention relates to novel serotonin derivatives of formula (I): or a pharmaceutically acceptable salt and/or solvate thereof. The present invention relates to novel serotonin derivatives of formula (I): or a pharmaceutically acceptable salt and/or solvate thereof. Another object of the present invention relates to the use of compound of formula (I) as a drug, in particular in the prevention and/or the treatment of iron overload-associated disorders.

Classes IPC  ?

• A61K 31/4045 - Indole-alkylamines; Leurs amides, p.ex. sérotonine, mélatonine
• A61P 7/06 - Antianémiques
• A61P 25/28 - Médicaments pour le traitement des troubles du système nerveux des troubles dégénératifs du système nerveux central, p.ex. agents nootropes, activateurs de la cognition, médicaments pour traiter la maladie d'Alzheimer ou d'autres formes de démence
• C07D 209/16 - Tryptamines
• C07D 405/12 - Composés hétérocycliques contenant à la fois un ou plusieurs hétérocycles comportant des atomes d'oxygène comme uniques hétéro-atomes du cycle et un ou plusieurs hétérocycles comportant des atomes d'azote comme uniques hétéro-atomes du cycle contenant deux hétérocycles liés par une chaîne contenant des hétéro-atomes comme chaînons

Abrégé

The present invention relates to tertiary amine compounds, containing an alkyne group or an azide group, in particular an alkyne group, including their pharmaceutically acceptable salts and solvates, which are useful to monitor DNA lesions and to reveal interstrand crosslinks repair defects, in particular in patients selected from Fanconi Anemia (FA) patients, xeroderma pigmentosum (XP) patients, acute myeloid leukemia (AML) patients, head-and-neck cancer patients, ovarian cancer patients and breast cancer patients.

Classes IPC  ?

• C07C 237/20 - Amides d'acides carboxyliques, le squelette carboné de la partie acide étant substitué de plus par des groupes amino ayant les atomes de carbone des groupes carboxamide liés à des atomes de carbone acycliques du squelette carboné le squelette carboné contenant des cycles aromatiques à six chaînons
• A61P 7/06 - Antianémiques

Abrégé

Inventors have identified glycerol-3-phosphate (G3P) and phosphoethanolamine (PEtn) metabolism as potent regulators of the senescent program at the nexus of TAG and PL metabolism. They show that Glycerol kinase (GK) and Phosphate Cytidylyltransferase 2 Ethanolamine (Pcyt2) activities, which catalyse regulatory steps in TAG and PL synthesis impact G3P and PEtn levels in a homeostatic fashion controlling the senescence program. Finally, they provide evidence that pharmacological inhibitors of GK activity act senomorphic, thus suggesting a novel therapeutic target for interventions in age-related diseases and cancer. The present invention relates to a method for treating senescence related disease in a subject in need thereof comprising administering said subject with a therapeutically effective amount of a modulator of Glycerol kinase (GK), Glycerol 3 phosphate phosphatase (G3PP), Ethanolamine-Phosphate Phospho-Lyase (ETNPPL) and/or Phosphate Cytidylyltransferase 2 (PCYT2).

Classes IPC  ?

• A61K 31/095 - Composés du soufre, du sélénium ou du tellure, p.ex. thiols
• A61K 31/7088 - Composés ayant au moins trois nucléosides ou nucléotides
• A61K 31/7105 - Acides ribonucléiques naturels, c. à d. contenant uniquement des riboses liés à l'adénine, la guanine, la cytosine ou l'uracile et ayant des liaisons 3'-5' phosphodiester 
• A61K 31/713 - Acides nucléiques ou oligonucléotides à structure en double-hélice
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p.ex. composés antiphlogistiques et pour le cœur 
• A61P 39/00 - Agents protecteurs généraux ou antipoisons
• A61P 43/00 - Médicaments pour des utilisations spécifiques, non prévus dans les groupes

Abrégé

The present invention relates to a compound of the formula (I): (I). The present invention further relates to the process for extracting it, to the medicament or pharmaceutical composition containing it and to its use in therapy, in particular in the prevention and/or treatment of cancer and virus infections.

Classes IPC  ?

• A61P 35/00 - Agents anticancéreux
• A61K 38/00 - Préparations médicinales contenant des peptides
• C07K 7/64 - Peptides cycliques ne comportant que des liaisons peptidiques normales

Abrégé

Ocular Rosacea (OR) is a chronic inflammatory and neurovascular diseases of the ocular surface and eyelids. associated with abnormal tear film lipids that can lead to corneal neovascularization, loss of transparency and ulceration. Here, the inventors show that the combination of mineralocorticoid receptor blockade in association with local ocular glucocorticoids that have high GR binding affinity, have superior effects as compared to MR blockade alone, without the side effects of glucocorticoids on corneal wound healing. The combination of MR antagonist and low dose of a GR activator further reduces corneal edema, corneal neovascularization and improves corneal wound healing. The combination of MR antagonist and triamcinolone that has a strong GR binding affinity reinforces the beneficial effects of MR antagonists. Finally, the inventors show that MR is overexpressed in ocular surface tissues and Meibomian glands of patients with ocular rosacea, and that transgenic rats that over express the human MR have molecular markers in their meibomian glands, similar to those of patients with OR. Thus, MR antagonists and GR agonist with strong GR affinity is a suitable combination for the treatment of OR.

Classes IPC  ?

• A61K 31/585 - Composés contenant des systèmes cycliques du cyclopenta[a]hydrophénanthrène; Leurs dérivés, p.ex. stéroïdes contenant des hétérocycles, p.ex. danazol, stanozolol, pancuronium ou digitogénine contenant des cycles lactone, p.ex. oxandrolone, bufaline
• A61K 31/4375 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p.ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle condensés en ortho ou en péri avec des systèmes hétérocycliques le système hétérocyclique contenant un cycle à six chaînons ayant l'azote comme hétéro-atome du cycle, p.ex. quinolizines, naphtyridines, berbérine, vincamine
• A61K 31/573 - Composés contenant des systèmes cycliques du cyclopenta[a]hydrophénanthrène; Leurs dérivés, p.ex. stéroïdes substitués en position 17 bêta par une chaîne à deux atomes de carbone, p.ex. prégnane ou progestérone substitués en position 21, p.ex. cortisone, dexaméthasone, prednisone ou aldostérone
• A61K 31/575 - Composés contenant des systèmes cycliques du cyclopenta[a]hydrophénanthrène; Leurs dérivés, p.ex. stéroïdes substitués en position 17 bêta par une chaîne d'au moins trois atomes de carbone, p.ex. cholane, cholestane, ergostérol, sitostérol
• A61P 27/02 - Agents ophtalmiques
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p.ex. oligonucléotides anti-sens

Abrégé

The invention pertains to new viral-like particles (VLPs), pharmaceutical compositions comprising the same and methods of using the same to prevent or treat an infection by a Coronaviridae virus. Advantageously, these VLPs can be used as a vaccine to be orally or nasally administrated.

Classes IPC  ?

• A61K 39/215 - Coronaviridae, p.ex. virus de la bronchite infectieuse aviaire
• A61K 39/00 - Préparations médicinales contenant des antigènes ou des anticorps
• A61K 39/12 - Antigènes viraux
• A61P 31/14 - Antiviraux pour le traitement des virus ARN
• C12N 7/00 - Virus, p.ex. bactériophages; Compositions les contenant; Leur préparation ou purification

Abrégé

Disclosed is an oligomeric compound comprising from 10 to 50 monomer subunits, at least part of the sequence of which is complementary to the following sequence: AAGGAAACUGCCAUCUCCAA (SEQ ID NO: 1 in the appended sequence listing). Also disclosed is a pharmaceutical composition comprising said oligomeric compound and use for treating Duchenne Muscular Dystrophy.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p.ex. oligonucléotides anti-sens
• A61K 47/54 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p.ex. les supports ou les additifs inertes; Agents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p.ex. conjugués polymère-médicament l’ingrédient non actif étant un agent de modification l’agent de modification étant un composé organique
• A61P 21/00 - Médicaments pour le traitement des troubles du système musculaire ou neuromusculaire

Abrégé

The invention relates to a method for removing uremic toxins bound to a protein from the blood of a patient in need thereof. The method comprises the introduction in the blood of a displacer substance chosen from (C6-C12)-fatty acids, salts of (C6-C12)-fatty acids, a precursor of said (C6-C12)-fatty acids, or mixtures thereof. The displacer substance replaces the uremic toxins bound to the protein, thereby releasing unbound uremic toxins in the blood. The unbound uremic toxins are then removed from the blood by any method of dialysis. The method according to the invention involves low concentrations of displacer substance and is effective at plasma concentrations comprised in the range of from 0.5 to 3 mM.

Classes IPC  ?

• A61M 1/16 - Systèmes de dialyse; Reins artificiels; Oxygénateurs du sang avec membranes
• A61K 31/00 - Préparations médicinales contenant des ingrédients actifs organiques 
• A61M 1/34 - Filtration du sang à travers une membrane pour en éliminer une matière, c. à d. hémofiltration, diafiltration
• A61M 1/36 - Autre traitement du sang dans une dérivation du système circulatoire naturel, p.ex. adaptation de la température, irradiation

Abrégé

The invention relates to a method for removing uremic toxins bound to a protein from the blood of a patient in need thereof. The method comprises the introduction in the blood of a displacer substance chosen from (C6-C12)-fatty acids, salts of (C6-C12)-fatty acids, a precursor of said (C6-C12)-fatty acids, or mixtures thereof. The displacer substance replaces the uremic toxins bound to the protein, thereby releasing unbound uremic toxins in the blood. The unbound uremic toxins are then removed from the blood by any method of dialysis. The method according to the invention involves low concentrations of displacer substance and is effective at plasma concentrations comprised in the range of from 1 µM to 3 mM.

Classes IPC  ?

• A61M 1/16 - Systèmes de dialyse; Reins artificiels; Oxygénateurs du sang avec membranes
• A61K 31/00 - Préparations médicinales contenant des ingrédients actifs organiques 
• A61M 1/34 - Filtration du sang à travers une membrane pour en éliminer une matière, c. à d. hémofiltration, diafiltration
• A61M 1/36 - Autre traitement du sang dans une dérivation du système circulatoire naturel, p.ex. adaptation de la température, irradiation
• A61K 31/19 - Acides carboxyliques, p.ex. acide valproïque
• A61K 31/20 - Acides carboxyliques, p.ex. acide valproïque ayant un groupe carboxyle lié à une chaîne acyclique d'au moins sept atomes de carbone, p.ex. acides stéarique, palmitique ou arachidique

Abrégé

PIM2 kinase deregulation has been reported in several cancers. In particular, PIM2 is considered in multiple myeloma as part of the oncogenic process and several PIM kinase inhibitors have been developed showing encouraging results in preclinical studies and clinical trials. Now the inventors have developed an antisense RNA strategy based on a splice-switching oligonucleotide (SSO) so as to induce efficient knockdown of PIM2 expression. This SSO-mediated knockdown is a powerful approach to for cancer treatments. Accordingly, the present invention relates to the use of splice switching oligonucleotides for exon skipping-mediated knockdown of PIM2.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p.ex. oligonucléotides anti-sens

Abrégé

The tumoral stroma evolution during cancer is playing a key role as it may acts as a physical barrier limiting access of the immune cells to the tumor. Thus, βig-h3 (TGFβi) overexpression in the stroma is of bad prognosis in Pancreatic Ductal Adenocarcinoma and in other cancers. A monoclonal antibody against βig-h3 protein called 18B3 was shown playing a role in directly modulating the anti-tumoral immune response by blocking inhibiting CD8+ T cell activation. From 18B3 the inventors developed humanized antibodies having unexpectedly high affinity, slow dissociation rate and strong thermal stability making them powerful candidates for treating cancers wherein the stroma expresses βig-h3 in vivo. The invention thus relates to these humanized monoclonal antibodies and methods of treatment of such cancers.

Classes IPC  ?

• C07K 16/22 - Immunoglobulines, p.ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des facteurs de croissance
• A61K 39/00 - Préparations médicinales contenant des antigènes ou des anticorps
• A61P 35/00 - Agents anticancéreux

Abrégé

The invention relates to the field of patient's care and describes method and systems, for prediction of mortality, functional outcome and recovery after status epilepticus, based on machine classifiers and logistic regression functions, and using biological markers and variables easily obtainable in intensive care units.

Classes IPC  ?

• G16H 50/30 - TIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicales; TIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour l’évaluation des risques pour la santé d’une personne
• G01N 33/68 - Analyse chimique de matériau biologique, p.ex. de sang ou d'urine; Test par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligands; Test immunologique faisant intervenir des protéines, peptides ou amino-acides
• G16H 10/60 - TIC spécialement adaptées au maniement ou au traitement des données médicales ou de soins de santé relatives aux patients pour des données spécifiques de patients, p.ex. pour des dossiers électroniques de patients
• G16H 20/10 - TIC spécialement adaptées aux thérapies ou aux plans d’amélioration de la santé, p.ex. pour manier les prescriptions, orienter la thérapie ou surveiller l’observance par les patients concernant des médicaments ou des médications, p.ex. pour s’assurer de l’administration correcte aux patients

Abrégé

Autism Spectrum Disorders (ASD) are neurodevelopmental disorders whose diagnosis relies on deficient social interaction and communication together with repetitive behavior. To date, no pharmacological treatment has been approved that ameliorates social behavior in patients with ASD. Based on the excitation/inhibition imbalance theory of autism, the Inventors hypothesized that bromide ions, long used as an antiepileptic medication, could relieve core symptoms of ASD. They evaluated the effects of chronic sodium bromide (NaBr) administration on autistic-like symptoms in three genetic mouse models of autism: Oprm1−/−, Fmr1−/− and Shank3Δex13-16−/− mice. They showed that chronic NaBr treatment relieved autistic-like behaviors in these three models. In Oprm1−/− mice, these beneficial effects were superior to those of chronic bumetanide administration. At transcriptional level, chronic NaBr in Oprm1 null mice was associated with increased expression of genes coding for chloride ions transporters, GABAA receptor subunits, oxytocin and mGlu4 receptor. Lastly, they uncovered synergistic alleviating effects of chronic NaBr and a positive allosteric modulator (PAM) of mGlu4 receptor on autistic-like behavior in Oprm1−/− mice. They evidenced in heterologous cells that bromide ions behave as PAMs of mGlu4, providing a molecular mechanism for such synergy. Their data reveal the therapeutic potential of bromide ions, alone or in combination 0 with a PAM of mGlu4 receptor, for the treatment of ASDs.

Classes IPC  ?

• A61K 31/167 - Amides, p.ex. acides hydroxamiques ayant des cycles aromatiques, p.ex. colchicine, aténolol, progabide ayant l'atome d'azote d'un groupe carboxamide lié directement au cycle aromatique, p.ex. lidocaïne, paracétamol
• A61K 33/00 - Préparations médicinales contenant des ingrédients actifs inorganiques
• A61P 25/00 - Médicaments pour le traitement des troubles du système nerveux

Abrégé

in vitroin vitroin vitro method according to any one of the preceding claims, for use as a medicament.

Classes IPC  ?

• G01N 33/58 - Analyse chimique de matériau biologique, p.ex. de sang ou d'urine; Test par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligands; Test immunologique faisant intervenir des substances marquées
• G01N 33/68 - Analyse chimique de matériau biologique, p.ex. de sang ou d'urine; Test par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligands; Test immunologique faisant intervenir des protéines, peptides ou amino-acides

Abrégé

An in vitro method is disclosed for characterizing a tumour, based on the quantitative analysis of modified and unmodified nucleosides from total cellular RNA, from extracellular RNA and/or from isolated nucleosides, extracted from a biological sample. More particularly, the invention relates to a method for predicting the grade of a glial tumour. More particularly, the invention also relates to a method for detecting a tumour. The present invention therefore lies in the fields of cancerology and molecular biology, more particularly applied to medical diagnosis.

Classes IPC  ?

• G16H 50/50 - TIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicales; TIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour la simulation ou la modélisation des troubles médicaux
• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN
• G01N 30/02 - Chromatographie sur colonne
• G01N 30/72 - Spectromètres de masse
• G01N 30/88 - Systèmes intégrés d'analyse, spécialement adaptés à cet effet, non couverts par un seul des groupes
• G01N 33/574 - Tests immunologiques; Tests faisant intervenir la formation de liaisons biospécifiques; Matériaux à cet effet pour le cancer
• G06N 3/09 - Apprentissage supervisé
• G16H 10/60 - TIC spécialement adaptées au maniement ou au traitement des données médicales ou de soins de santé relatives aux patients pour des données spécifiques de patients, p.ex. pour des dossiers électroniques de patients

Abrégé

The present invention relates to a method and kit for identifying a subject having or at risk of having or developing an isolated neonatal systemic hypertension (NSH) and/or NSH associated cardiogenic shock, comprising determining, in a sample obtained from said subject, the presence or absence of bi-allelic nucleotide variants (NV) located in NPR1 gene, said NV predicted to be pathogenic and being associated with NPR1 loss of function. The present inventors have established a statistical link between specific predicted pathogenic variants located in the NPR1 gene and neonatal systemic hypertension (NSH) in a cohort of NSH disease families. More precisely, the present inventors have established a link between specific predicted biallelic pathogenic variants contained in NPR1 in patients with NSH and/or cardiogenic shock (in multiplex and consanguineous families) associated sometime with increased Nuchal Translucency (NT). Another object of the invention relates to a method for treating neonatal systemic hypertension (NSH) and/or NSH associated cardiogenic shock.

Classes IPC  ?

• C12Q 1/6883 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p.ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique

Abrégé

The invention concerns a new galenic formulation of CFT (clofoctol) allowing the administration of this antibiotic in aerosol form with the objective of treating pulmonary infections (COVID-19, influenza), cancer and inflammation thus targeting the diseased tissue while avoiding the problems of solubility of CFT and toxicity associated with this drug. This new formulation allows to answer these problems and concerns the development of polymeric nanoparticles (Nanoparticles) in suspension in an aqueous phase intended to be administrated in a form of aerosol or spray, said Nanoparticles comprising PLGA and PLGA-PEG polymers, allowing to obtain an effective encapsulation of CFT and a controlled release of CFT at the pulmonary level.

Classes IPC  ?

• A61K 9/51 - Nanocapsules

Abrégé

Hepatitis D virus (HDV) infection is the most severe form of chronic viral hepatitis due to rapid progression towards liver-related death and hepatocellular carcinoma. Now the inventors have demonstrated that CYP3A4 inhibitors can be useful for the treatment of HDV infections. In particular, the inventors showed that ritonavir a very potent CYP3A4 inhibitor had a significant impact on the secretion of HBs. The effects were confirmed with Saquinavir and Ketoconazole on the secretion of HBs. Finally, the inventors showed that ritonavir has a limited effect on the replication of HBV and HDV in coinfected cells, but dramatically reduced the number of infectious particles in culture supernatants. Accordingly, the present invention relates to the use of CYP3A4 inhibitors for the treatment of hepatitis D virus (HDV) infections.

Classes IPC  ?

• A61K 31/427 - Thiazoles non condensés et contenant d'autres hétérocycles
• A61K 31/397 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p.ex. guanéthidine ou rifamycines ayant des cycles à quatre chaînons, p.ex. azétidine
• A61K 31/4725 - Isoquinoléines non condensées, p.ex. papavérine contenant d'autres hétérocycles
• A61K 31/496 - Pipérazines non condensées contenant d'autres hétérocycles, p.ex. rifampine, thiothixène
• A61K 31/513 - Pyrimidines; Pyrimidines hydrogénées, p.ex. triméthoprime ayant des groupes oxo liés directement à l'hétérocycle, p.ex. cytosine
• A61K 31/675 - Composés du phosphore ayant l'azote comme hétéro-atome d'un cycle, p.ex. phosphate de pyridoxal
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p.ex. composés antiphlogistiques et pour le cœur 
• A61P 31/14 - Antiviraux pour le traitement des virus ARN

Abrégé

Type 1 conventional dendritic cells (cDC1s) and plasmacytoid dendritic cells (pDCs) are thought to be critical for anti-tumor or antiviral immunity. In vitro differentiation systems have unlocked the ability to produce large numbers of these cells. However, a method is lacking to systematically identify the cell-intrinsic factors controlling their differentiation and functions that remain therefore poorly understood, in contrast to the situation in mice. Here, the inventors developed a workflow for efficient gene silencing and its tracing in human cDC1s/pDCs generated in vitro. They demonstrate the key role of IRF8 in their development, and of IRF7/MyD88 in human pDC production of interferons-α/λ. They found that SAMHD1 and RAB7B promote human cDC1 differentiation, while SEPT3 promotes human pDC differentiation. Finally, they identified that the transcription factors ID2 and DC-SCRIPT versus BCL11A promote cDC1 versus pDC development respectively. This approach will enable broader genetic screens to advance our understanding of human cDC1s/pDCs and harness them against viral infections or cancer. Thus, the present invention relates to a method for inducing the differentiation of human hematopoietic stem cells into type 1 conventional dendritic cells or plasmacytoid dendritic cells, while genetically manipulating the hematopoietic stem cells to modulate the differentiation and/or functions of their dendritic cell progeny.

Classes IPC  ?

• C12N 5/0784 - Cellules dendritiques; Leurs progéniteurs

Abrégé

The present invention pertains to an improved method for the diagnosis of homologous recombination deficiency (HRD) in a tumor The method according to the invention particularly comprises evaluating the number of large-scale genomic alterations (LGA) by obtaining the copy number alterations (CNA) profile by shallow coverage whole genome sequencing (sWGS) in a tumor sample, and determining a LGA-score which corresponds to the LGA number adjusted by the genome complexity of the tumor and the presence of one or two markers selected from the group of markers consisting of (1) cyclin dependent kinase 12 (CDK12) mutation-associated phenotype with multiple interstitial gains in the CNA profile, (2) Cyclin E1 (CCNE1) amplification, (3) human epidermal growth factor receptor-2 (HER2) amplification and (4) multifocal amplification phenotype.

Classes IPC  ?

• C12Q 1/6886 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p.ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique pour le cancer

Abrégé

The disclosure relates to a method for releasing platelets from megakaryocytes contained in a fluid (F), the method being carried out by means of a system comprising two concentric cylinders, an inner cylinder comprising a cylindrical wall and a hollow outer cylinder located radially external to the inner cylinder, the outer cylinder comprising a cylindrical wall of a base at which the second cylinder is closed, the cylinders being separated by a space devoid of any mechanical parts, the space being intended to receive the fluid (F), the method comprising the following steps: supplying the space with a fluid (F) comprising megakaryocytes, rotating the inner cylinder about its axis, the outer cylinder being stationary, or moving the two cylinders in opposite directions about their axes, so as to generate an at least partially turbulent flow of fluid (F) in the space and obtain a second fluid (F′) enriched in platelets.

Classes IPC  ?

• C12M 1/00 - Appareillage pour l'enzymologie ou la microbiologie
• C12M 3/04 - Appareillage pour la culture de tissus, de cellules humaines, animales ou végétales, ou de virus comportant des moyens fournissant des couches minces

Abrégé

System for monitoring respiratory suffering or discomfort on a patient, the system comprising an acquisition device including at least a video camera and configured to acquire an image stream of the face of said patient, the system being configured to measure the respiratory rate of said patient and the cardiac rate of said patient, the system being configured to: detect on said image stream at least one predefined facial cue on the face of said patient associated to respiratory distress, an action score being attributed based on the presence or absence of said facial cue(s), attribute a respiratory score based on the measured value of the respiratory rate, attribute a cardiac score based on the measured value of the cardiac rate, compute a global score, and if said global score is greater than a predefined threshold, trigger an action, especially an alarm, to indicate respiratory distress.

Classes IPC  ?

• A61B 5/00 - Mesure servant à établir un diagnostic ; Identification des individus
• A61B 5/024 - Mesure du pouls ou des pulsations cardiaques
• A61B 5/145 - Mesure des caractéristiques du sang in vivo, p.ex. de la concentration des gaz dans le sang, de la valeur du pH du sang
• A61M 16/00 - Dispositifs pour agir sur le système respiratoire des patients par un traitement au gaz, p.ex. bouche-à-bouche; Tubes trachéaux
• G16H 50/20 - TIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicales; TIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour le diagnostic assisté par ordinateur, p.ex. basé sur des systèmes experts médicaux
• G06V 10/143 - Détection ou éclairage à des longueurs d’onde différentes
• G06V 10/82 - Dispositions pour la reconnaissance ou la compréhension d’images ou de vidéos utilisant la reconnaissance de formes ou l’apprentissage automatique utilisant les réseaux neuronaux
• G06V 20/52 - Activités de surveillance ou de suivi, p.ex. pour la reconnaissance d’objets suspects
• G06V 40/16 - Visages humains, p.ex. parties du visage, croquis ou expressions
• A61B 5/0205 - Evaluation simultanée de l'état cardio-vasculaire et de l'état d'autres parties du corps, p.ex. de l'état cardiaque et respiratoire

Abrégé

The invention relates to a pharmaceutical composition for use in a method for the treatment of cancer and/or immune deficiency diseases and/or infectious diseases, comprising a metal ion and optionally hyaluronate (HA) or a hyaluronate conjugate, wherein said method comprises the intralymphatic administration of the pharmaceutical composition to a subject. The invention also relates to a pharmaceutical combination for use in a method for the treatment of cancer, the pharmaceutical combination comprising: (i) at least one metal ion, preferably selected in the group consisting of iron (Fe), copper (Cu), manganese (Mn), calcium (Ca), magnesium (Mg),zinc (Zn), and mixtures thereof; and (ii) hyaluronate (HA) or a hyaluronate conjugate, wherein said method comprises the simultaneous, separate or sequential administration of (i) and (ii) directly into the lymphatic system, preferably into a lymph node or a lymph vessel.

Classes IPC  ?

• A61K 33/06 - Aluminium, calcium ou magnésium; Leurs composés
• A61K 33/26 - Fer; Ses composés
• A61K 33/30 - Zinc; Ses composés
• A61K 33/32 - Manganèse; Ses composés
• A61K 33/34 - Cuivre; Ses composés
• A61P 31/00 - Agents anti-infectieux, c. à d. antibiotiques, antiseptiques, chimiothérapeutiques
• A61P 35/00 - Agents anticancéreux
• A61P 37/04 - Immunostimulants

Abrégé

The present invention relates to a new and specific T-cell therapy strategy based on the use of memory stem T-cells (Tscm). This new cellular immunotherapy may be applied to PML patients but also to other infections or cancers for which the specific memory T cell responses are functionally impaired.

Classes IPC  ?

• C12N 5/0783 - Cellules T; Cellules NK; Progéniteurs de cellules T ou NK
• C12N 5/00 - Cellules non différenciées humaines, animales ou végétales, p.ex. lignées cellulaires; Tissus; Leur culture ou conservation; Milieux de culture à cet effet
• A61K 35/17 - Lymphocytes; Lymphocytes B; Lymphocytes T; Cellules tueuses naturelles; Lymphocytes activés par un interféron ou une cytokine

Abrégé

The present invention relates to the treatment or prevention of skeletal disorders, in particular skeletal diseases, developed by patients that display abnormal increased activation of the fibroblast growth factor receptor 3 (FGFR3), in particular by expression of a constitutively activated mutant of FGFR3.

Classes IPC  ?

• A61K 31/506 - Pyrimidines; Pyrimidines hydrogénées, p.ex. triméthoprime non condensées et contenant d'autres hétérocycles
• A61K 31/519 - Pyrimidines; Pyrimidines hydrogénées, p.ex. triméthoprime condensées en ortho ou en péri avec des hétérocycles
• A61K 38/17 - Peptides ayant plus de 20 amino-acides; Gastrines; Somatostatines; Mélanotropines; Leurs dérivés provenant d'humains
• B29C 48/00 - Moulage par extrusion, c. à d. en exprimant la matière à mouler dans une matrice ou une filière qui lui donne la forme désirée; Appareils à cet effet
• B29K 25/00 - Utilisation de polymères de composés vinylaromatiques comme matière de moulage
• B29K 35/00 - Utilisation de polymères d'acides polycarboxyliques non saturés comme matière de moulage
• B29K 201/00 - Utilisation de cellulose, de cellulose modifiée ou de dérivés de cellulose, p.ex. de viscose, comme matière de renforcement
• B29L 31/00 - Autres objets particuliers
• B32B 27/30 - Produits stratifiés composés essentiellement de résine synthétique comprenant une résine acrylique
• C08J 5/18 - Fabrication de bandes ou de feuilles
• C08L 25/06 - Polystyrène
• C08L 51/04 - Compositions contenant des polymères greffés dans lesquels le composant greffé est obtenu par des réactions faisant intervenir uniquement des liaisons non saturées carbone-carbone; Compositions contenant des dérivés de tels polymères greffés sur des caoutchoucs

Abrégé

This document provides methods and materials related to treating a disease. For example, this document provides methods for treating a subject's disease based on identifying the risk of progressive multifocal leukoencephalopathy PML using a genetic test.

Classes IPC  ?

• C12Q 1/6883 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p.ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique

Abrégé

Here, a suite of methods and devices is provided, allowing the implementation of a strategy for Non-Invasive Prenatal Testing (NIPT) results validation in clinical practice: a package to perform NIPT analysis, a semi-supervised approach to create synthetic sequences and to estimate confidence intervals for aneuploidies prediction and a package to test the reliability of NIPT results based on confidence intervals. These new tools were validated on 2 cohorts including confirmed ancuploidies, demonstrating sensitivity and specificity of 100%. Thus, the invention relates to a method for assessing the fetal fraction (ff) and sequencing depth (sd) in NIPT; devices for implementing the method, computer program products and computer readable mediums. This result yields the conclusion that thresholds of ff, sd and E value need to be assessed for each data analysis pipeline, chromosome and cohort. The provided devices and methods are thus of wide interest as it allows to identify these thresholds in a laboratory—specific fashion to improve NIPT performances.

Classes IPC  ?

• G16B 20/10 - Ploïdie ou détection du nombre de copies
• C12Q 1/6827 - Tests d’hybridation pour la détection de mutation ou de polymorphisme
• G16B 40/20 - Analyse de données supervisée
• G16H 10/40 - TIC spécialement adaptées au maniement ou au traitement des données médicales ou de soins de santé relatives aux patients pour des données relatives aux analyses de laboratoire, p.ex. pour des analyses d’échantillon de patient
• G16H 50/20 - TIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicales; TIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour le diagnostic assisté par ordinateur, p.ex. basé sur des systèmes experts médicaux

Abrégé

Method for imaging vascular activity at a microscopic scale in at least one area of a vascular network of an organ, of a human or animal, the method including: (a) transmitting a series of successive incident ultrasonic waves in the at least one area by an array of ultrasonic transducers, the array of ultrasonic transducers extending along at least one direction and the incident ultrasonic waves being propagated in a direction perpendicular to the array of transducers; (b) acquiring a set of raw data from backscattered ultrasonic waves by said array of transducers; (c) generating a series of successive ultrasound images from said raw data; (d) detecting at least one isolated ultrasound contrast agent in the ultrasound images; (e) localizing the position of said at least one isolated ultrasound contrast agent with a precision inferior to the wavelength of the waves; (f) generating an at least 2D backscattering amplitude image by attributing for each pixel a value representative of the measured backscattering amplitude of at least one isolated ultrasound contrast agent detected in said pixel.

Classes IPC  ?

• A61B 8/06 - Mesure du débit sanguin
• A61B 8/08 - Détection de mouvements ou de changements organiques, p.ex. tumeurs, kystes, gonflements

Abrégé

The present invention relates to 3,5-diaminotriazole derivatives of formula (I) and pharmaceutical or veterinary compositions comprising such derivatives. It further relates to the compounds of formula (I) for use for treating an ocular disease, preferably diabetic retinopathy, macular degeneration, neovascular glaucoma, macular oedema or Stargardt's disease.

Classes IPC  ?

• C07D 249/14 - Atomes d'azote
• C07D 401/12 - Composés hétérocycliques contenant plusieurs hétérocycles comportant des atomes d'azote comme uniques hétéro-atomes du cycle, au moins un cycle étant un cycle à six chaînons avec un unique atome d'azote contenant deux hétérocycles liés par une chaîne contenant des hétéro-atomes comme chaînons
• A61P 27/02 - Agents ophtalmiques

Abrégé

The invention pertains to isolated population of tumor-associated macrophage cell populations, their use in prognosing the malignancy and the outcome of solid tumors, as well as compounds which inhibit the expression of certain genes in these macrophage cells, in tumor-associated macrophage populations, for use for treating a solid cancer in a subject in need thereof.

Classes IPC  ?

• C12N 5/0786 - Monocytes; Macrophages

Abrégé

The present invention primarily relates to a protein, in this case decorin, or a fragment thereof, for use in the treatment of an eye disease in a person in need thereof (i) the eye disease being characterised by a tear in or partial or total loss of the retinal pigment epithelium (RPE) in the person; and (ii) the protein comprising a protein sequence that comprises at least 85% sequence identity with the sequence SEQ ID NO: 1 or with the sequence SEQ ID NO: 2. The invention also relates to the implementation, for the same purpose, of a nucleic acid sequence encoding such a protein, and to the use of this protein, or a fragment thereof, or of the nucleic acid sequence to repair or regenerate a retinal pigment epithelium (RPE) in a person in need thereof.

Classes IPC  ?

• A61K 38/17 - Peptides ayant plus de 20 amino-acides; Gastrines; Somatostatines; Mélanotropines; Leurs dérivés provenant d'humains
• A61K 9/00 - Préparations médicinales caractérisées par un aspect particulier
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiques; Thérapie génique
• A61P 27/02 - Agents ophtalmiques
• C12N 15/62 - Séquences d'ADN codant pour des protéines de fusion
• C12N 15/85 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes eucaryotes pour cellules animales
• A61K 39/395 - Anticorps; Immunoglobulines; Immunsérum, p.ex. sérum antilymphocitaire
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p.ex. composés antiphlogistiques et pour le cœur 

Abrégé

The invention relates to a method and a system for estimating an epileptogenic zone network in a brain of an epileptic patient. According to the invention, the method comprises the steps of providing a mathematical model of an epileptogenic zone, wherein the mathematical model is provided with epileptogenicity parameters; loading the mathematical model in the virtual brain to create a virtual epileptic brain; acquiring three-dimensional structural data representative of the anatomy of the brain of the epileptic patient; personalising the virtual epileptic brain according to the structural data to obtain a personalised brain model; acquiring functional data recordings representative of epileptic seizures in the brain of the epileptic patient, the functional data recordings being acquired non-invasively by performing a deep brain temporal interference stimulation of the brain of the patient; and inverting the personalised brain model of the patient to infer the epileptogenicity parameters specific to the patient for the various zones or nodes of the virtual epileptic model of the brain of the patient.

Classes IPC  ?

• A61B 5/00 - Mesure servant à établir un diagnostic ; Identification des individus
• A61N 1/04 - Electrodes
• A61N 1/36 - Application de courants électriques par électrodes de contact courants alternatifs ou intermittents pour stimuler, p.ex. stimulateurs cardiaques
• G16H 20/30 - TIC spécialement adaptées aux thérapies ou aux plans d’amélioration de la santé, p.ex. pour manier les prescriptions, orienter la thérapie ou surveiller l’observance par les patients concernant des thérapies ou des activités physiques, p.ex. la physiothérapie, l’acupression ou les exercices
• G16H 50/50 - TIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicales; TIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour la simulation ou la modélisation des troubles médicaux

Abrégé

The invention relates to a method for inferring a change in a whole-brain network in a brain of a mammal. The method comprises the steps of providing a computerized platform modelling various regions of a mammal brain and connectivity between these regions; providing three-dimensional anatomical structural imaging data of the brain of the mammal; providing a parametric mathematical neural model describing an evolution of the neural field in a brain of a mammal; providing magnetic resonance imaging time-series data of the brain; fitting the model with the magnetic resonance imaging time-series acquired; estimating the parameters of the model; inverting the model; and inferring the change in the whole-brain network in the mammal ' s brain.

Classes IPC  ?

• A61B 5/00 - Mesure servant à établir un diagnostic ; Identification des individus
• A61N 1/36 - Application de courants électriques par électrodes de contact courants alternatifs ou intermittents pour stimuler, p.ex. stimulateurs cardiaques
• A61N 1/04 - Electrodes

Abrégé

Method for imaging vascular activity at a microscopic scale in at least one area of a vascular network of an organ, of a human or animal, the method including: (a) transmitting a series of successive incident ultrasonic waves in the at least one area by an array of ultrasonic transducers, the array of ultrasonic transducers extending along at least one direction and the incident ultrasonic waves being propagated in a direction perpendicular to the array of transducers; (b) acquiring a set of raw data from backscattered ultrasonic waves by said array of transducers; (c) generating a series of successive ultrasound images from said raw data; (d) detecting at least one isolated ultrasound contrast agent in the ultrasound images; (e) localizing the position of said at least one isolated ultrasound contrast agent with a precision inferior to the wavelength of the waves; (f) generating an at least 2D backscattering amplitude image by attributing for each pixel a value representative of the measured backscattering amplitude of at least one isolated ultrasound contrast agent detected in said pixel.

Classes IPC  ?

• A61B 8/08 - Détection de mouvements ou de changements organiques, p.ex. tumeurs, kystes, gonflements
• A61B 8/00 - Diagnostic utilisant des ondes ultrasonores, sonores ou infrasonores
• G06T 7/11 - Découpage basé sur les zones
• G06T 7/246 - Analyse du mouvement utilisant des procédés basés sur les caractéristiques, p.ex. le suivi des coins ou des segments
• G06T 7/73 - Détermination de la position ou de l'orientation des objets ou des caméras utilisant des procédés basés sur les caractéristiques
• G06T 11/00 - Génération d'images bidimensionnelles [2D]

Abrégé

The present disclosure provides improved methods, compositions, agents, therapeutic regimens, and systems for cancer treatment, such as improving the outcome of chemo- and/or immunotherapies, and/or inducing autophagy in subjects through the inhibition of extracellular diazepam binding inhibitor (DBI) by various methods.

Classes IPC  ?

• A61K 31/573 - Composés contenant des systèmes cycliques du cyclopenta[a]hydrophénanthrène; Leurs dérivés, p.ex. stéroïdes substitués en position 17 bêta par une chaîne à deux atomes de carbone, p.ex. prégnane ou progestérone substitués en position 21, p.ex. cortisone, dexaméthasone, prednisone ou aldostérone
• C07K 16/44 - Immunoglobulines, p.ex. anticorps monoclonaux ou polyclonaux contre du matériel non prévu ailleurs
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p.ex. composés antiphlogistiques et pour le cœur 
• A61P 35/00 - Agents anticancéreux

Abrégé

The invention relates to a deep brain stimulation system and method for electrically stimulating a region located in a brain of a mammal, comprising a first and a second pair of stimulation electrodes capable of delivering a stimulating electric alternating current at a second frequency of at least 800 Hz and at a second phase; a difference between the first carrier frequency and the second carrier frequency being of at least 0.5 Hz; the first phase being approximately equal to the second phase; at least a first pair of anti-stimulation electrodes capable of delivering an electric alternating current at a carrier frequency substantially equal to the first carrier frequency or the second carrier frequency or substantially equal to a multiple of these first or second carrier frequencies, but having a phase shift of approximately 180 ° as compared to the first and/or second phase.

Classes IPC  ?

• A61N 1/36 - Application de courants électriques par électrodes de contact courants alternatifs ou intermittents pour stimuler, p.ex. stimulateurs cardiaques
• A61N 1/04 - Electrodes

Abrégé

An activator for preserving and regenerating muscle structure and function activates the thyroid-stimulating hormone receptor (TSHR) signaling pathway in muscle stem cells (satellite cells), thereby blocking senescence. A medical product includes a plurality of activators, such as a genetic activator, and an adenoviral vector comprising a thyroid-stimulating hormone receptor (TSHR) protein sequence of SEQ ID NO: 1, or a TSHR nucleotide sequence of SEQ ID NO: 2.

Classes IPC  ?

• C07K 14/72 - Récepteurs; Antigènes de surface cellulaire; Déterminants de surface cellulaire pour des hormones
• A61K 31/352 - Composés hétérocycliques ayant l'oxygène comme seul hétéro-atome d'un cycle, p.ex. fungichromine ayant des cycles à six chaînons avec un oxygène comme seul hétéro-atome d'un cycle condensés avec des carbocycles, p.ex. cannabinols, méthanthéline
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiques; Thérapie génique
• C12N 15/86 - Vecteurs viraux
• C12N 15/88 - Introduction de matériel génétique étranger utilisant des procédés non prévus ailleurs, p.ex. co-transformation utilisant la micro-encapsulation, p.ex. utilisant des vésicules liposomiques

Abrégé

Despite the significant progress that has been made in its treatment, autoimmune associated diabetes places a severe burden on affected individuals as well as on society. The arrest or even the slowing of further destruction of β-cells would lead to prolonged remission period and delay diabetes-related complications. The PD-1-PDL1 system is crucial to the preservation of tolerance to pancreatic beta cell antigens and, if disrupted, immune-mediated beta cell loss might proceed more quickly in genetically predisposed individuals. Accordingly, increasing the expression of PDL1 on pancreatic β-cells would a suitable strategy for the treatment of type 1 diabetes. The inventors now demonstrate that pentylamine donors such as tryptophan can increase the expression of PDL1 on pancreatic β-cells without increasing the expression of MHC class I molecules. They confirm the observations in human islets. Accordingly, the present invention relates to use of pentylamine donors for the treatment of type 1 diabetes.

Classes IPC  ?

• A61K 35/39 - Appareil digestif Îlots de Langerhans
• A61K 31/4045 - Indole-alkylamines; Leurs amides, p.ex. sérotonine, mélatonine
• A61K 31/405 - Acides indole-alkanecarboxyliques; Leurs dérivés, p.ex. tryptophane, indométhacine
• C12N 5/071 - Cellules ou tissus de vertébrés, p.ex. cellules humaines ou tissus humains
• A61K 39/395 - Anticorps; Immunoglobulines; Immunsérum, p.ex. sérum antilymphocitaire
• A61P 3/10 - Médicaments pour le traitement des troubles du métabolisme de l'homéostase du glucose de l'hyperglycémie, p.ex. antidiabétiques
• C12N 5/00 - Cellules non différenciées humaines, animales ou végétales, p.ex. lignées cellulaires; Tissus; Leur culture ou conservation; Milieux de culture à cet effet
• A61K 31/52 - Purines, p.ex. adénine
• A61K 31/573 - Composés contenant des systèmes cycliques du cyclopenta[a]hydrophénanthrène; Leurs dérivés, p.ex. stéroïdes substitués en position 17 bêta par une chaîne à deux atomes de carbone, p.ex. prégnane ou progestérone substitués en position 21, p.ex. cortisone, dexaméthasone, prednisone ou aldostérone
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p.ex. composés antiphlogistiques et pour le cœur 

Abrégé

This monitoring system (4), for measuring a quantity of blood lost by a woman having given birth vaginaly, includes a port-partum blood flow collection container (42), a weighing device (44, 446) configured to automatically and continuously weigh blood present in the container, a computing unit (82) configured to automatically compute a blood volume (Vb) in the container (42) and a blood flow rate (Fb) of blood flowing into the container, on the basis of an output signal (S446) of the weighing device. The monitoring system (4) also includes a screen (48) configured to display both a first value of the blood volume (Vb) in the container (42), computed by the computing unit (82), and a second value of the blood flow rate (Fb), also computed by the computing unit (82).

Classes IPC  ?

• G01G 17/04 - Appareils ou méthodes pour peser un produit ayant une forme ou des propriétés particulières pour peser des fluides, p.ex. des gaz, des produits pâteux
• A61B 5/02 - Mesure du pouls, du rythme cardiaque, de la pression sanguine ou du débit sanguin; Détermination combinée du pouls, du rythme cardiaque, de la pression sanguine; Evaluation d'un état cardio-vasculaire non prévue ailleurs, p.ex. utilisant la combinaison de techniques prévues dans le présent groupe et des techniques d'électrocardiographie; Sondes cardiaques pour mesurer la pression sanguine
• A61B 5/00 - Mesure servant à établir un diagnostic ; Identification des individus
• A61G 13/10 - Tables d'opération; Leurs accessoires - Parties constitutives, détails ou accessoires

Abrégé

Dendritic cells (DCs) control the activation and infiltration of CD8+ T cells within the tumor microenvironment (TME). This process supports the immune control of tumors and explain the efficiency of immune checkpoint blockade immunotherapy. However, DC infiltration in tumors is typically low and controlled by immunosuppressive mechanisms activated by tumors. Here, the inventors propose a new approach to promote DC infiltration in solid tumors, increase anti- tumor specific T cell responses and achieve the activation of anti-tumor immunity. This approach is based on the intra-tumoral engraftment within solid tumors of autologous engineered stromal cells delivering factors favoring DC infiltration. Specifically, fibroblasts engineered to express the membrane bound form of FLT3L (eMSC-FLT3L) induce anti-tumor immunity when combined with adjuvant like the poly(I:C) double stranded RNA mimic. DC infiltration, T cell activation and the therapeutic anti-tumor effect is uniquely dependent on the presence of both eMSC-FLT3L and poly(I:C). Mechanistic experiments demonstrate that poly(I:C)-induced chemokine (CXCR3 and CCR5 ligands) are required for the therapeutic effect of eMSC-FLT3L + poly(I:C). Finally, stromal cell-based delivery of chemokines (CXCR3, CCR5 or XCR1 ligands) together with membrane bound form of FLT3L is sufficient to activate anti-tumor immunity in the absence of poly(I:C). Altogether, these data support the therapeutic potential of intra-tumoral engraftment of autologous mesenchymal stromal cells to induce anti-tumor immunity.

Classes IPC  ?

• C12N 5/077 - Cellules mésenchymateuses, p.ex. cellules osseuses, cellules de cartilage, cellules stromales médulaires, cellules adipeuses ou cellules musculaires

Abrégé

The present invention relates to the combination of anti-CD3 agent, in particular monoclonal antibody, with immunotherapeutic agents, and its use in oncology, for treating T Cell Acute Lymphoblastic Leukemia (T-ALL). The invention also relates to a pharmaceutical composition comprising said combination and the use of said combination to induce cell death of T-ALL cells.

Classes IPC  ?

• C07K 16/28 - Immunoglobulines, p.ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire
• A61P 35/02 - Agents anticancéreux spécifiques pour le traitement de la leucémie

Abrégé

The present invention concerns novel Multilineage-differentiating stress enduring (Muse) cells, for use for treating a pathology selected from radiation-induced pathologies and pathologies of the intestine (preferably radiation-induced gastrointestinal syndrome (CIS)), wherein the Muse cells are SSEA-3+CD105+. The present invention also relates to compositions comprising Muse cells for use for treating a pathology selected from radiation-induced pathologies and pathologies of the intestine (preferably radiation-induced gastrointestinal syndrome (CIS)). The present invention also provides methods for treating a pathology selected from radiation-induced pathologies and pathologies of the intestine (preferably radiation-induced gastrointestinal syndrome (CIS)), comprising the administration of a therapeutically effective amount of Muse cells to a subject in need thereof.

Classes IPC  ?

• A61K 35/28 - Moelle osseuse; Cellules souches hématopoïétiques; Cellules souches mésenchymateuses de toutes origines, p.ex. cellules souches dérivées de tissu adipeux
• A61P 37/00 - Médicaments pour le traitement des troubles immunologiques ou allergiques
• A61P 39/00 - Agents protecteurs généraux ou antipoisons
• A61P 1/00 - Médicaments pour le traitement des troubles du tractus alimentaire ou de l'appareil digestif
• C12N 5/00 - Cellules non différenciées humaines, animales ou végétales, p.ex. lignées cellulaires; Tissus; Leur culture ou conservation; Milieux de culture à cet effet