Abstract

A system for detecting a biological target in a sample, including a sensor comprised of single-walled nanotubes coating a sample substrate, where the sensor includes a sensing electrode and a control electrode, and an analyzer configured to accept the sensor including a controller configured to measure a resistance of the sensing electrode and a resistance of the control electrode and compare the resistance of the sensing electrode to the resistance of the control electrode. Additionally, a method of detecting a biological target with the system including placing a sample into an analyzer, inserting a sensor made of single-walled carbon nanotubes into the analyzer, wherein the sensor includes a sensing electrode and a control electrode, submerging the sensing electrode into the sample, submerging the sensing electrode into a washing solution, measuring the resistance of the sensing electrode and the control electrode, and comparing the resistances.

IPC Classes  ?

• G01N 33/543 - ImmunoassayBiospecific binding assayMaterials therefor with an insoluble carrier for immobilising immunochemicals
• G01N 33/569 - ImmunoassayBiospecific binding assayMaterials therefor for microorganisms, e.g. protozoa, bacteria, viruses

Abstract

De novo designed polypeptides that bind to IL-2 receptor βc heterodimer (IL-2Rβc), IL-4 receptor αc heterodimer (IL-4Rαc), or IL-13 receptor α subunit (IL-13Rα) are disclosed, as are methods for using and designing the polypeptides.

IPC Classes  ?

• C07K 14/55 - IL-2
• A61K 38/00 - Medicinal preparations containing peptides
• A61K 47/60 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
• A61K 47/62 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
• C07K 14/54 - Interleukins [IL]

Abstract

Methods of uniquely labeling or barcoding molecules within a nucleus, a plurality of nuclei, a cell, a plurality of cells, and/or a tissue are provided. Kits for uniquely labeling or barcoding molecules within a nucleus, a plurality of nuclei, a cell, a plurality of cells, and/or a tissue are also provided. The molecules to be labeled may include, but are not limited to, RNAs and/or cDNAs.

IPC Classes  ?

• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Abstract

Zwitterionic carboxybetaine copolymers and their use in coatings to impart non-fouling and functionality to surfaces, particularly surfaces of blood-contacting medical devices.

IPC Classes  ?

• C09D 133/26 - Homopolymers or copolymers of acrylamide or methacrylamide
• A61L 29/04 - Macromolecular materials
• A61L 29/06 - Macromolecular materials obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds
• A61L 29/08 - Materials for coatings
• A61L 29/14 - Materials characterised by their function or physical properties
• C08J 3/28 - Treatment by wave energy or particle radiation

Abstract

A method of fabricating a wearable and elastically stretchable thermoelectric generator or other thermoelectric device can involve arranging thermoelectric pellets and printing a thermal insulation material alongside and/or around the thermoelectric pellets to form a core layer. The core layer can be cured, and a liquid metal can be selectively deposited on the thermoelectric pellets to form contact points. Printing conductive ink can form stretchable electrical interconnects that define connections among the thermoelectric pellets via the contact points to form an initial middle layer that includes the stretchable electrical interconnects. Printing a thermal interface material may form an initial outer layer positioned between the initial outer layer and an initial side of the core layer to form a layered assembly. The layered assembly may be inverted and receive additional printed layers building away from the core layer, such as an additional interconnect layer and an additional thermal interface layer.

IPC Classes  ?

• H10N 10/01 - Manufacture or treatment
• H10N 10/17 - Thermoelectric devices comprising a junction of dissimilar materials, i.e. devices exhibiting Seebeck or Peltier effects operating with only the Peltier or Seebeck effects characterised by the structure or configuration of the cell or thermocouple forming the device
• H10N 10/82 - Interconnections

Abstract

Methods of uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are provided. Kits for uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are also provided. The molecules to be labeled may include, but are not limited to, RNAs, cDNAs, DNAs, proteins, peptides, and/or antigens.

IPC Classes  ?

• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
• C12Q 1/6855 - Ligating adaptors

Abstract

Methods of uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are provided. Kits for uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are also provided. The molecules to be labeled may include, but are not limited to, RNAs, cDNAs, DNAs, proteins, peptides, and/or antigens.

IPC Classes  ?

• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
• C12Q 1/6855 - Ligating adaptors

Abstract

Methods of uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are provided. Kits for uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are also provided. The molecules to be labeled may include, but are not limited to, RNAs, cDNAs, DNAs, proteins, peptides, and/or antigens.

IPC Classes  ?

• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
• C12Q 1/6855 - Ligating adaptors

Abstract

Provided is a method of operating a storage system including a host device, which includes a zone manager, and a storage device. The method includes allocating, by the zone manager, a first essential write resource, a second essential write resource, a first spare write resource, and a second spare write resource to a first logical zone, allocating, by the zone manager, a third essential write resource, a fourth essential write resource, a third spare write resource, and a fourth spare write resource to a second logical zone, and reallocating, by the zone manager, the first spare write resource and the second spare write resource to the second logical zone.

IPC Classes  ?

• G06F 12/02 - Addressing or allocationRelocation

Abstract

Polypeptides having an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NO: 1-381, not including any amino acid insertions at identified loop positions, are provided that bind to II- 6R, GP130, or IL-1R, and which can be used to treat or limit development of Cytokine release syndrome and other disorders.

IPC Classes  ?

• C07K 14/00 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof
• A61K 38/16 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof
• A61P 29/00 - Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agentsNon-steroidal antiinflammatory drugs [NSAID]
• A61P 37/06 - Immunosuppressants, e.g. drugs for graft rejection
• C12N 15/62 - DNA sequences coding for fusion proteins
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

An intrauterine system configured to be retained in a uterus of a patient, the intrauterine system including a delivery system configured to deliver one or more active compounds, where the one or more active compounds have non-systemic extrauterine biological targets. Further, a method of using the intrauterine system, including retaining the intrauterine system in a uterus, and delivering the one or more active compounds to non-systemic extrauterine biological targets in the lower female reproductive tract (LFRT) or the rectum.

IPC Classes  ?

• A61K 9/00 - Medicinal preparations characterised by special physical form
• A61K 31/439 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom the ring forming part of a bridged ring system, e.g. quinuclidine
• A61K 31/4439 - Non-condensed pyridinesHydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
• A61K 31/505 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim
• A61K 31/513 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
• A61K 31/522 - Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
• A61K 31/65 - Tetracyclines
• A61K 47/34 - Macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyesters, polyamino acids, polysiloxanes, polyphosphazines, copolymers of polyalkylene glycol or poloxamers

Abstract

Polypeptides are disclosed having an amino acid sequence at least 50% identical to the amino acid sequence of SEQ ID NO:1, wherein, relative to SEQ ID NO:1, residue 43 is I, residue 95 is Q, and residue 128 is L, fusion proteins thereof, kits thereof, and methods for using the polypeptides for treating a disorder associated with cortisol, or for detecting cortisol in a biological sample.

IPC Classes  ?

• C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
• A61K 38/00 - Medicinal preparations containing peptides
• G01N 33/53 - ImmunoassayBiospecific binding assayMaterials therefor
• G01N 33/74 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing involving hormones

Abstract

Provided herein are compositions and methods directed toward the discovery of improved methods for generating deoxyATP (dATP) in cells that can be delivered to a graft site in the heart to enhance cardiac function.

IPC Classes  ?

• C12N 5/077 - Mesenchymal cells, e.g. bone cells, cartilage cells, marrow stromal cells, fat cells or muscle cells
• C12N 9/02 - Oxidoreductases (1.), e.g. luciferase
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Various implementations described herein relate to devices, systems, and methods for inducing and/or causing cellular migration and uses thereof. Implementations described herein can be used to cause a portion of a cell population to migrate in response to a differential stimulus. Implementations described herein can be used to isolate and characterize the portion of the cell population. Implementations described herein can be used for research, diagnostic, or therapeutic purposes.

IPC Classes  ?

• C12M 1/00 - Apparatus for enzymology or microbiology
• C12M 1/12 - Apparatus for enzymology or microbiology with sterilisation, filtration, or dialysis means
• C12M 1/42 - Apparatus for the treatment of microorganisms or enzymes with electrical or wave energy, e.g. magnetism, sonic wave

Abstract

A flat nanophotonic computational camera, which employs an array of skewed lenslets (meta-optics) and a learned reconstruction approach is disclosed herein. The optical array is embedded on a metasurface that with a height of approximately one micron, is flat and sits on the sensor cover glass at approximately 2.5 mm focal distance from the sensor. A differentiable optimization method continuously samples over the visible spectrum and factorizes the optical modulation for different incident fields into individual lenses. A megapizel image is reconstructed from a flat imager with a learned probabilistic reconstruction method that employs a generative diffusion model to sample an implicit prior. A method for acquiring paired captured training data in varying illumination conditions is proposed. The proposed flat camera design is assessed in simulation and with an experimental prototype, validating that the method is capable of recovering images from diverse scenes in broadband with a single nanophotonic layer.

IPC Classes  ?

• H04N 23/55 - Optical parts specially adapted for electronic image sensorsMounting thereof
• H04N 23/69 - Control of means for changing angle of the field of view, e.g. optical zoom objectives or electronic zooming

Abstract

The invention provides isolated polypeptides, fusion proteins, isolated nucleic acid molecules, nucleic acid vectors, host cells, nanostructures, composite nanostructures, and pharmaceutical compositions. The invention further provides methods of treating a disease or disorder, medical uses, and uses involving said products of the invention. The invention further provides methods of forming a nanostructure and methods of forming a composite nanostructure. The isolated polypeptides and fusion proteins have the ability to form a nanostructure in the presence of ATP.

IPC Classes  ?

• C07K 14/195 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from bacteria
• B82Y 5/00 - Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
• A61P 31/00 - Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• A61P 35/00 - Antineoplastic agents
• A61P 37/00 - Drugs for immunological or allergic disorders
• A61K 38/00 - Medicinal preparations containing peptides
• C07K 19/00 - Hybrid peptides

Abstract

In some embodiments, a method of controlling speed of an ego vehicle in a vehicle platoon is provided. Cooperative adaptive cruise control (CACC) commands based on at least one of a vehicle-to-vehicle communication control received from a preceding vehicle and a feedback control based on a sensor output of a long-range sensor of the ego vehicle are provided to a speed controller. In response to detecting an occluded state, a minimum spacing value and a minimum relative velocity value between the ego vehicle and the preceding vehicle are determined based on information received before the detection of the occluded state; a safety speed based on the minimum spacing value and the minimum relative velocity value is determined; and an occluded adaptive cruise control command is provided to the speed controller to maintain a speed of the ego vehicle that is less than or equal to the safety speed.

IPC Classes  ?

• B60W 30/165 - Control of distance between vehicles, e.g. keeping a distance to preceding vehicle automatically following the path of a preceding lead vehicle, e.g. "electronic tow-bar"
• B60W 10/06 - Conjoint control of vehicle sub-units of different type or different function including control of propulsion units including control of combustion engines
• G08G 1/00 - Traffic control systems for road vehicles

Abstract

In one aspect, a wearable device includes a first temperature sensor configured to be positioned to detect an external ear temperature at an ear, and a second temperature sensor configured to dangle below the ear to detect an ambient temperature. The wearable device may include a controller coupled to the first temperature sensor and the second temperature sensor. The wearable device may also include an antenna coupled to the controller, where the antenna and the controller are configured to communicate data indicative of the external ear temperature and the ambient temperature. The communicated data can then be analyzed using a computing system to determine and/or detect an event based on the data indicative of external ear temperature and the data indicative of ambient temperature.

IPC Classes  ?

• A61B 5/01 - Measuring temperature of body parts
• A61B 5/00 - Measuring for diagnostic purposes Identification of persons

Abstract

The present disclosure features, inter alia, a cyclic multifunctional linker, including at least two cleavable moieties; at least two connecting chains connected to the at least two cleavable moieties to provide a cyclic structure; and at least two linking groups, each linking group being bonded at one end to a connecting chain and being located between two cleavable moieties, and each linking group having a second end configured to bond to crosslinkable moieties. In the cyclic multifunctional linker, each connecting chain has at least two ends, and at least two of the connecting chains are each connected at each end to a cleavable moiety.

IPC Classes  ?

• A61K 47/65 - Peptidic linkers, binders or spacers, e.g. peptidic enzyme-labile linkers
• A61K 47/69 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit

Abstract

This application relates to oligomer barcodes for labeling extracellular vesicles (EVs). The labeled extracellular vesicles can be used to monitor EV movement for research purposes and for the development of treatments in a variety of diseases and disorders.

IPC Classes  ?

• G01N 33/58 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing involving labelled substances

Abstract

Examples of systems, wearable devices and computing systems described herein may enroll one or more target audio sources responsive to an indication. The indication may provide a direction of the target audio source. The enrollment may utilize audio signals received during an enrollment phase. Computing systems described herein may generate target audio source signals based on subsequent audio signals, utilizing audio characteristics of the target audio source generated during enrollment. The target audio source signals may be binaural audio signals. The target audio source signals may be played back through binaural speakers such that directionality of the target audio source is preserved.

IPC Classes  ?

• H04R 5/027 - Spatial or constructional arrangements of microphones, e.g. in dummy heads
• H04S 7/00 - Indicating arrangementsControl arrangements, e.g. balance control
• G01S 3/808 - Systems for determining direction or deviation from predetermined direction using transducers spaced apart and measuring phase or time difference between signals therefrom, i.e. path-difference systems
• G10L 21/028 - Voice signal separating using properties of sound source
• G10L 25/30 - Speech or voice analysis techniques not restricted to a single one of groups characterised by the analysis technique using neural networks
• H04R 1/32 - Arrangements for obtaining desired frequency or directional characteristics for obtaining desired directional characteristic only

Abstract

Disclosed herein are polypeptides that include (a) a heptad motif domain comprising an amino acid sequence according to the genus (I-X1-X2-I-X3-X4-X5)n, wherein X1, X2, X3, X4, and X5 may independently be any amino acid other than proline, and wherein n can be 1-30; and (b) a second domain selected from the group consisting of (i) a polypeptide antigen, and (ii) a polypeptide component of a nanoparticle, nanoparticles including such polypeptides, and uses thereof.

IPC Classes  ?

• A61K 39/145 - Orthomyxoviridae, e.g. influenza virus
• A61K 39/00 - Medicinal preparations containing antigens or antibodies
• A61P 31/16 - Antivirals for RNA viruses for influenza or rhinoviruses
• C07K 14/005 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from viruses
• C12N 7/00 - Viruses, e.g. bacteriophagesCompositions thereofPreparation or purification thereof

Abstract

Spatial light modulators and associated methods are described. In one embodiment, a spatial light modulator includes a photonic integrated circuit configured for emitting a plurality of light beams as a first waveform by a plurality of pixels. The light beams are individually controllable. The spatial light modulator also includes a meta-optic having a plurality of nanostructures configured for receiving the first waveform and aggregating the plurality of light beams as a second waveform at a surface of the meta-optic. The spatial light modulator also includes an aperture array configured for converting the second waveform into a third waveform, where the third waveform is smaller than the second waveform.

IPC Classes  ?

• G02F 1/01 - Devices or arrangements for the control of the intensity, colour, phase, polarisation or direction of light arriving from an independent light source, e.g. switching, gating or modulatingNon-linear optics for the control of the intensity, phase, polarisation or colour
• G02B 6/12 - Light guidesStructural details of arrangements comprising light guides and other optical elements, e.g. couplings of the optical waveguide type of the integrated circuit kind

Abstract

Provided herein are methods of detecting severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) in a sample. The methods include contacting the sample with a plurality of gold nanoparticles (AuNPs) and/or other plasmonic metal nanoparticles (MNPs) that are conjugated with at least two sets of antibodies, or antigen binding portions thereof, that binds to at least first and second epitopes of SARS-CoV-2 proteins, such as receptor-binding domain (RBDs) under conditions sufficient for the antibodies, or the antigen binding portions thereof, to bind to the first and second epitopes of the SARS-CoV-2 proteins in the sample to produce bound SARS-CoV-2 proteins. The methods also include detecting the SARS-CoV-2 proteins when aggregations of the bound SARS-CoV-2 proteins form with one another. Related compositions, reaction mixtures, devices, kits, and systems are also provided.

IPC Classes  ?

• G01N 33/569 - ImmunoassayBiospecific binding assayMaterials therefor for microorganisms, e.g. protozoa, bacteria, viruses
• G01N 33/543 - ImmunoassayBiospecific binding assayMaterials therefor with an insoluble carrier for immobilising immunochemicals
• G01N 33/553 - Metal or metal coated

Abstract

Described herein is a generalizable strategy to rapidly and irreversibly activate protein function with full spatiotemporal control. Through development of an exogenously triggerable self-assembling protein construct, bioactive proteins can be stably reassembled from non-functional split fragment pairs following exposure to a stimulus (e.g., light).

IPC Classes  ?

• C07K 14/46 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates
• C12N 9/02 - Oxidoreductases (1.), e.g. luciferase
• C12N 9/12 - Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)

Abstract

Integrin α5β1-binding polypeptides are disclosed having an amino acid sequence at least 50% identical to the amino acid sequence selected from SEQ ID NO:1-14, or selected from SEQ ID NO:11-14, not including any insertions, wherein residues 8-10 relative to the reference polypeptide are RGD, and their use for treating cancer, vascular disease, rheumatoid arthritis, and diseases associated with pathogenic, angiogenesis.

Abstract

Disclosed are systems for polymer-mediated activation of an engineered cell. The disclosed systems include (a) a polymer displaying a universal epitope and a moiety that specifically binds to a component of a tissue or cell of interest and (b) an engineered cell comprising (i) an engineered receptor that specifically recognizes the universal epitope via an extracellular binding domain and (ii) a transgene comprising a polynucleotide encoding a therapeutic protein, wherein the polynucleotide is operatively linked to an inducible promoter driven by an activation signal from an intracellular signaling domain of the engineered receptor upon engagement of the receptor with the universal epitope. Also disclosed are methods for delivering a therapeutic protein to the site of a tissue or cell of interest by administering the disclosed polymer and engineered cell. In some variations, the engineered cell is a chimeric antigen receptor (CAR) cell and/or the moiety binds to an extracellular matrix component. In some aspects, the system is useful in methods for treating a solid tumor cancer.

IPC Classes  ?

• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
• A61K 40/31 - Chimeric antigen receptors [CAR]
• C12N 5/0783 - T cellsNK cellsProgenitors of T or NK cells
• A61K 51/08 - Peptides, e.g. proteins
• C07K 16/18 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans
• C07K 7/08 - Linear peptides containing only normal peptide links having 12 to 20 amino acids
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy

Abstract

An electrostatic clutch includes a shaft having an electrically conductive first layer. The clutch also includes a hold attachment rotatably coupled to the shaft and a tension band having an electrically conductive second layer. The tension band is wrapped around the shaft such that a first end of the tension band is coupled to the hold attachment. The clutch includes a dielectric material disposed between the first layer and the second layer and a load attachment rotatably coupled to the shaft. The clutch is configured for an engaged mode where a voltage applied between the first layer and the second layer causes the tension band to clasp the shaft and the load attachment and the hold attachment to be rotationally locked to the shaft, and for a disengaged mode where the voltage is absent and the shaft can rotate freely with respect to the load attachment and the hold attachment.

IPC Classes  ?

• H02N 13/00 - Clutches or holding devices using electrostatic attraction, e.g. using Johnson-Rahbek effect
• F16D 28/00 - Electrically-actuated clutches

Abstract

Provided herein are isolated nucleic acids that encode a stable form of Rrm2 for the use of increasing the intracellular Rrm2 protein levels and cytosolic 2-deoxy-ATP (dATP) levels. Further provided herein are methods for treating a cardiac disease or disorder, e.g., myocardial infarction or myocardial ischemia, by administering the isolated nucleic acids, a polypeptide encoded by the isolated nucleic acids, or composition comprising the isolated nucleic acids to a subject in need thereof.

IPC Classes  ?

• A61K 38/44 - Oxidoreductases (1)
• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• C12N 15/52 - Genes encoding for enzymes or proenzymes
• C12N 15/86 - Viral vectors

Abstract

Crosslinked films having electro-optic activity, compositions and compounds for making the films, methods for making the films, and devices that include the films are disclosed.

IPC Classes  ?

• C08F 220/14 - Methyl esters
• C08F 220/16 - Esters of monohydric alcohols or phenols of phenols or of alcohols containing two or more carbon atoms
• C08F 220/30 - Esters containing oxygen in addition to the carboxy oxygen containing aromatic rings in the alcohol moiety
• C08J 3/24 - Crosslinking, e.g. vulcanising, of macromolecules
• C08J 5/18 - Manufacture of films or sheets
• G02F 1/361 - Organic materials

Abstract

A system may control a mass spectrometer to acquire, during a plurality of acquisitions constituting an acquisition cycle, a set of mass spectra of product ions derived from precursor ions isolated based on a parallel isolation window successively positioned throughout a precursor mass-to-charge ratio (m/z) range. The precursor m/z range is divided into a plurality of isolation window units. The parallel isolation window includes, for each acquisition of the acquisition cycle, a set of isolation sub-windows corresponding to a distinct set of isolation window units of the precursor m/z range. At least two adjacent isolation sub-windows of the parallel isolation window are non-contiguous. Each isolation window unit of the precursor m/z range is analyzed at least twice during the acquisition cycle. A mass spectrum for the precursor m/z range may be generated based on the set of mass spectra acquired during the acquisition cycle.

IPC Classes  ?

• H01J 49/42 - Stability-of-path spectrometers, e.g. monopole, quadrupole, multipole, farvitrons
• G01N 30/02 - Column chromatography
• G01N 30/72 - Mass spectrometers

Abstract

Embodiments of the present disclosure provide compositions and methods for increasing nutrient uptake by plants and for effecting soil remediation. Embodiments of the composition and methods comprise a hydrogel bead, a microbial consortia, and a fungi, and can additionally comprise an excipient for administration of the hydrogel bead comprising the microbial consortia and the fungi, one or more seed, water, one or more nutrients, and combinations thereof. Such composition and methods have broad application to reduce fertilizer requirements and use, and to increase plant nutrient access and uptake. The composition and methods have additional application to remediate contaminated mediums such as soil contaminated with chemicals, petroleum, and explosives.

IPC Classes  ?

• C05F 11/08 - Organic fertilisers containing added bacterial cultures, mycelia or the like
• A01N 25/26 - Biocides, pest repellants or attractants, or plant growth regulators, characterised by their forms, or by their non-active ingredients or by their methods of applicationSubstances for reducing the noxious effect of the active ingredients to organisms other than pests in coated particulate form
• A01N 63/20 - BacteriaSubstances produced thereby or obtained therefrom
• A01N 63/30 - Microbial fungiSubstances produced thereby or obtained therefrom
• A01P 21/00 - Plant growth regulators
• C05G 5/35 - Capsules, e.g. core-shell
• C09K 17/00 - Soil-conditioning materials or soil-stabilising materials

Abstract

Three to four residue non-naturally occurring macrocycle oligoamide comprising a chemotype of 3 or 4 monomer residues selected from the group consisting of a, b, c, d, e, f, g, h, I, j, k, l, m, n, o, p, q, r, s, t, u, and v monomers as defined in Table 1 are provided, and methods for design of such macrocycle oligoamides

IPC Classes  ?

• G16B 15/00 - ICT specially adapted for analysing two-dimensional or three-dimensional molecular structures, e.g. structural or functional relations or structure alignment
• C07K 4/00 - Peptides having up to 20 amino acids in an undefined or only partially defined sequenceDerivatives thereof
• G16B 40/00 - ICT specially adapted for biostatisticsICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding

Abstract

The present disclosure provides compounds and compositions that are useful as partial antagonist of IRE1α RNase (PAIR) or kinase inhibiting RNase attenuator (KIRA), such as compounds of Formula (I'): or a pharmaceutically acceptable salt, enantiomer, or stereoisomer thereof, and compositions comprising a compound of Formula (I'), or a pharmaceutically acceptable salt, enantiomer, or stereoisomer thereof, and a pharmaceutically acceptable excipient, and methods of using said compounds and compositions.

IPC Classes  ?

• C07D 417/04 - Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group containing two hetero rings directly linked by a ring-member-to-ring- member bond
• C07D 417/14 - Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group containing three or more hetero rings
• A61P 1/00 - Drugs for disorders of the alimentary tract or the digestive system
• A61P 3/10 - Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
• A61P 17/00 - Drugs for dermatological disorders
• A61P 25/00 - Drugs for disorders of the nervous system
• A61P 27/00 - Drugs for disorders of the senses
• A61P 29/00 - Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agentsNon-steroidal antiinflammatory drugs [NSAID]
• A61P 35/00 - Antineoplastic agents
• A61K 31/427 - Thiazoles not condensed and containing further heterocyclic rings
• A61K 31/506 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings

Abstract

Disclosed are methods and kits for detecting and visualizing biomolecules of interest, RNA molecules, and/or genomic loci, as well as the proteins, RNAs, or chromatin loci associated with the biomolecules of interest, RNA molecules, or genomic loci. The methods and kits can be used for elucidating molecular interactions in situ.

IPC Classes  ?

• C12Q 1/6874 - Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation [SBH]
• C12Q 1/6841 - In situ hybridisation
• G01N 33/68 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing involving proteins, peptides or amino acids

Abstract

The invention provides methods for preparing DNA sequencing libraries by assembling short read sequencing data into longer contiguous sequences for genome assembly, full length cDNA sequencing, metagenomics, and the analysis of repetitive sequences of assembled genomes.

IPC Classes  ?

• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
• C12N 15/66 - General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligationUse of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
• C12Q 1/6869 - Methods for sequencing
• C12Q 1/6874 - Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation [SBH]
• C40B 40/06 - Libraries containing nucleotides or polynucleotides, or derivatives thereof
• C40B 50/06 - Biochemical methods, e.g. using enzymes or whole viable microorganisms

Abstract

Provided herein are methods and compositions for delivering large proteins to a subject in need thereof for treatment of a disease or disorder. In certain embodiments, the methods and compositions described herein are useful in the delivery of large proteins to subjects using a protein expression system comprising at first and second AAV vector for the treatment of muscular or neuromuscular disease or disorders.

IPC Classes  ?

• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
• A61P 21/00 - Drugs for disorders of the muscular or neuromuscular system
• C12N 15/86 - Viral vectors

Abstract

Present apparatuses, systems, and methods are directed to the conservation of energy expended to power devices, components, systems, etc., on an aircraft, and to power aircraft manufacturing components used in the manufacture of an aircraft in an aircraft manufacturing facility using a highly flexible thermoelectric composite device to generate electrical current by converting waste heat into electrical energy.

IPC Classes  ?

• H10N 10/82 - Interconnections
• B60L 50/60 - Electric propulsion with power supplied within the vehicle using propulsion power supplied by batteries or fuel cells using power supplied by batteries
• B60L 50/90 - Electric propulsion with power supplied within the vehicle using propulsion power supplied by specific means not covered by groups , e.g. by direct conversion of thermal nuclear energy into electricity
• H10N 10/852 - Thermoelectric active materials comprising inorganic compositions comprising tellurium, selenium or sulfur

Abstract

Provided are extension devices and systems, including an extending truss including a plurality of cells, each cell including a first scissor extender including a first member and a second member rotationally connected to the first member at an off-center point along a longitudinal axis of the first member, a second scissor extender connected to the first scissor extender, the second scissor extender including a first member and a second member rotationally connected to the first member, and a third scissor extender connected to the first scissor extender, the third scissor extender including a first member and a second member rotationally connected to the first member.

IPC Classes  ?

• B66F 3/22 - Lazy-tongs mechanisms
• B66B 9/02 - Kinds or types of lifts in, or associated with, buildings or other structures actuated mechanically otherwise than by rope or cable
• B66F 7/06 - Lifting frames, e.g. for lifting vehiclesPlatform lifts with platforms supported by levers for vertical movement

Abstract

In some embodiments, a method of encoding a set of information bits to produce a codeword that encodes the set of information bits for reliable communication is provided. The set of information bits is received. The set of information bits are provided to a plurality of permutation layers separated by neural network processing layers. Each permutation layer accepts an input vector and generates a reordered output vector that is a reordering of the input vector. Each neural network processing layer accepts a vector of input values and generates a vector of output values based on a non-linear function of the vector of input values. The reordered output vector of a final permutation layer of the plurality of permutation layers is provided as the codeword. In some embodiments, a corresponding method of decoding a codeword to retrieve a set of information bits is provided.

IPC Classes  ?

• H03M 13/21 - Non-linear codes, e.g. m-bit data word to n-bit code word [mBnB] conversion with error detection or error correction
• H03M 13/00 - Coding, decoding or code conversion, for error detection or error correctionCoding theory basic assumptionsCoding boundsError probability evaluation methodsChannel modelsSimulation or testing of codes
• H03M 13/37 - Decoding methods or techniques, not specific to the particular type of coding provided for in groups

Abstract

Apparatuses, systems, and methods are directed for the use of at least one highly flexible thermoelectric device positioned in contact with and/or adjacent to heat-emitting aircraft assembly surfaces for the purpose of harvesting and/or converting energy in the form of heat to produce an electric current used to power an aircraft component.

IPC Classes  ?

• G01K 7/04 - Measuring temperature based on the use of electric or magnetic elements directly sensitive to heat using thermoelectric elements, e.g. thermocouples the object to be measured not forming one of the thermoelectric materials

Abstract

Various implementations described herein relate to methods and compositions for production of bacterial cellulose nanoparticles and uses thereof. According to some implementations, the size and shape of bacterial cellulose nanoparticles are controlled. The bacterial cellulose nanoparticles are linked to proteins to facilitate drug delivery, in some implementations. Various implementations described herein can be used for research, diagnostic, or therapeutic uses.

IPC Classes  ?

• C12P 19/04 - Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
• C08B 15/00 - Preparation of other cellulose derivatives or modified cellulose
• C12P 19/08 - Dextran

Abstract

in vivo in vivo function after adoptive transfer, enabling massively parallel interrogation of many treatments in animal models.

IPC Classes  ?

• G01N 33/50 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing
• A61K 35/17 - LymphocytesB-cellsT-cellsNatural killer cellsInterferon-activated or cytokine-activated lymphocytes
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 5/0783 - T cellsNK cellsProgenitors of T or NK cells
• C12Q 1/6804 - Nucleic acid analysis using immunogens
• C12Q 1/6869 - Methods for sequencing
• C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
• G16B 5/00 - ICT specially adapted for modelling or simulations in systems biology, e.g. gene-regulatory networks, protein interaction networks or metabolic networks

Abstract

Systems and methods for optimizing data-driven decision-making in multi-agent systems are described. The system may construct an equilibrium concept to capture multi-layer and/or k-level depth reasoning by agents. The system may determine best-response type conjectures for agents to interact with one another. In some examples, the system may include a machine or an algorithm interacting with a strategic agent (e.g., a human or an entity). The system may include methods for: (1) data-driven estimation and/or learning of conjectures and associated depth; and (2) data-driven design of algorithmic mechanisms for exploring the conjectural equilibrium (CE) space by influencing the strategic agent(s) behaviors through adaptively adjusting and estimating deployed strategies.

IPC Classes  ?

• G06N 20/00 - Machine learning
• G06F 3/01 - Input arrangements or combined input and output arrangements for interaction between user and computer

Abstract

An autonomous miniature robot is described. The autonomous robot may include a chassis, a drive system, actuators, capacitors, a power harvesting system, and a microcontroller. The microcontroller may selectively control how the power harvesting system charges the capacitors. When the microcontroller is being powered by a first capacitor, the microcontroller directs the power harvesting system to charge a second capacitor. The second capacitor is used to send power pulses to the drive system to propel the robot. When the charge of the first capacitor falls below a threshold, the microcontroller directs the power harvesting system to charge the first capacitor. This process of switching between charging the two capacitors and controlling the drive system is iteratively repeated to create motion. The robot may include a set of power harvesting sensors (e.g., photodiodes) that can be used to direct the trajectory of the robot towards areas of higher power intensity.

IPC Classes  ?

• H02J 7/16 - Regulation of the charging current or voltage by variation of field
• B25J 5/00 - Manipulators mounted on wheels or on carriages
• B60L 50/60 - Electric propulsion with power supplied within the vehicle using propulsion power supplied by batteries or fuel cells using power supplied by batteries
• B60L 53/20 - Methods of charging batteries, specially adapted for electric vehiclesCharging stations or on-board charging equipment thereforExchange of energy storage elements in electric vehicles characterised by converters located in the vehicle
• B60L 58/12 - Methods or circuit arrangements for monitoring or controlling batteries or fuel cells, specially adapted for electric vehicles for monitoring or controlling batteries responding to state of charge [SoC]

Abstract

Various implementations described herein relate to methods and compositions for targeted delivery of small molecules. According to some implementations, NAD+ and NAD+ precursors are encapsulated in a nanoparticle. To facilitate targeted delivery to the brain and other organs, the nanoparticle includes peptoids, or poly-N-substituted glycines. Particular implementations relate to the use of nanopeptoid-encapsulated NAD+ for treatment of acute brain injuries. Various implementations described herein can be used for research, diagnostic, or therapeutic uses.

IPC Classes  ?

• A61K 31/455 - Nicotinic acid, i.e. niacinDerivatives thereof, e.g. esters, amides
• A61K 38/00 - Medicinal preparations containing peptides
• A61K 47/69 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
• A61K 9/00 - Medicinal preparations characterised by special physical form
• B82Y 40/00 - Manufacture or treatment of nanostructures
• C07K 1/02 - General processes for the preparation of peptides in solution

Abstract

Modified polypeptides comprising an amino acid sequence having a lysine or derivative thereof functionalized at N6 with a seryl or threonyl group are disclosed, as are bioconjugates comprising the modified polypeptides, and methods for making the bioconjugates.

IPC Classes  ?

• C07K 14/605 - Glucagons
• A61K 38/00 - Medicinal preparations containing peptides
• A61K 47/54 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound

Abstract

Passive grippers can be computationally generated for grasping objects. For example, a method described herein for producing a passive gripper for the object can include identifying a set of grasp configurations for the object. The method can also include selecting, from the set, a particular grasp configuration configured for performing passive engagement and disengagement with the object. Additionally, the method can include generating a template for the passive gripper based on the particular grasp configuration. The method can include fabricating the passive gripper based on the template.

IPC Classes  ?

• G05B 19/4099 - Surface or curve machining, making 3D objects, e.g. desktop manufacturing
• B29C 64/386 - Data acquisition or data processing for additive manufacturing
• B33Y 10/00 - Processes of additive manufacturing
• B33Y 30/00 - Apparatus for additive manufacturingDetails thereof or accessories therefor
• B33Y 50/00 - Data acquisition or data processing for additive manufacturing

Abstract

Nucleic acids and expression vectors, and host cells or vesicles containing them, are provided that encode polypeptides and fusion proteins capable of forming hetero-oligomeric complexes capable of inducing membrane or vesicle fusion, and their use as delivery vehicles.

IPC Classes  ?

• C12N 15/88 - Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using liposome vesicle
• C07K 14/705 - ReceptorsCell surface antigensCell surface determinants
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Abstract

Various implementations described herein relate to methods and compositions for delivery of small molecules to the brain. According to some implementations, small molecules are encapsulated in a nanoparticle. Small molecules include NAD+ precursors. In some implementations, the nanoparticle includes poly(lactic-co-glycolic acid) (PLGA) and polyethylene glycol (PEG). Various implementations described herein can be used for research, diagnostic, or therapeutic uses.

IPC Classes  ?

• A61K 31/7084 - Compounds having two nucleosides or nucleotides, e.g. nicotinamide-adenine dinucleotide, flavine-adenine dinucleotide
• A61K 9/08 - Solutions
• A61K 9/127 - Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Abstract

An example plasma confinement system includes an inner electrode having a rounded first end that is disposed on a longitudinal axis of the plasma confinement system and an outer electrode that at least partially surrounds the inner electrode. The outer electrode includes a solid conductive shell and an electrically conductive material disposed on the solid conductive shell and on the longitudinal axis of the plasma confinement system. The electrically conductive material has a melting point within a range of 170° C to 800° C at 1 atmosphere of pressure. Related plasma confinement systems and methods are also disclosed herein.

IPC Classes  ?

• G21B 1/05 - Thermonuclear fusion reactors with magnetic or electric plasma confinement
• G21B 1/21 - Electric power supply systems, e.g. for magnet systems

Abstract

Apparatuses, systems, and methods are disclosed for regulating an eversion process in everting sheath systems to avoid uncontrolled deployment of the sheath. The sheath system includes a reel and a sheath stored thereon, where the sheath is capable of everting from a retracted position to an extended position as the reel rotates about a rotational axis. The rotational characteristics of the reel are controlled by a torque mechanism operable to directly or indirectly apply a passive torque to the reel to adjust a rate at which the sheath is released from the reel as the sheath everts from the retracted position to the extended position.

IPC Classes  ?

• B25J 18/06 - Arms flexible
• A61M 25/01 - Introducing, guiding, advancing, emplacing or holding catheters
• B25J 9/14 - Programme-controlled manipulators characterised by positioning means for manipulator elements fluid
• B25J 13/08 - Controls for manipulators by means of sensing devices, e.g. viewing or touching devices
• B25J 19/00 - Accessories fitted to manipulators, e.g. for monitoring, for viewingSafety devices combined with or specially adapted for use in connection with manipulators
• F03G 7/06 - Mechanical-power-producing mechanisms, not otherwise provided for or using energy sources not otherwise provided for using expansion or contraction of bodies due to heating, cooling, moistening, drying, or the like

Abstract

Described herein are compositions and methods related to enhancing cardiomyocyte transplant engraftment and methods of administering a transplant composition.

IPC Classes  ?

• A61K 35/34 - MusclesSmooth muscle cellsHeartCardiac stem cellsMyoblastsMyocytesCardiomyocytes
• A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
• A61K 38/19 - CytokinesLymphokinesInterferons
• A61K 38/20 - Interleukins
• A61K 38/21 - Interferons
• A61K 38/46 - Hydrolases (3)
• A61K 38/48 - Hydrolases (3) acting on peptide bonds (3.4)
• A61K 38/55 - Protease inhibitors
• C12N 5/077 - Mesenchymal cells, e.g. bone cells, cartilage cells, marrow stromal cells, fat cells or muscle cells
• C12N 15/86 - Viral vectors

Abstract

Embodiments of the present disclosure provide a single stranded nucleic acid construct with a predetermined number of binding sites, wherein the construct comprises a targeting domain, at least one signaling domain, and at least one splint oligonucleotide that hybridizes to complementary regions on the targeting domain and the signaling domain to form a ligation junction to link each domain to form a functional unit. The present disclosure also provides for methods of using the construct to quantify a target nucleic acid through signal intensity. In other embodiments, the disclosure provides use of the construct in multiplexed target detection methods.

IPC Classes  ?

• C12Q 1/6876 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
• C12Q 1/6841 - In situ hybridisation

Abstract

A polypeptide comprising a binder, the binder having a binding affinity to Sortilin-1 (Sort1) receptor and constructs thereof. The Sort1 binder capable of binding to the Sort1 receptor when the Sort1 receptor is in a protonated state, and wherein the polypeptide is further capable of being released from the Sort1 receptor when the Sort1 receptor is in a deprotonated state. The constructs a binder moiety and a cargo moiety, the cargo moiety linked to the binder moiety via a linker, the binder moiety being capable of binding to a Sortilin-1 (Sort1) receptor. The Sort1 binder and/or the construct comprising the Sort1 binder of use in promoting internalization a cargo, internalization of a therapeutic agent or extracellular protein degradation.

IPC Classes  ?

• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
• A61K 38/00 - Medicinal preparations containing peptides
• C07K 14/00 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof
• A61K 47/64 - Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
• C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals

Abstract

Proteins having luciferse activity are disclosed, having the secondary structure arrangement H1-L1-H2-L2-E1-L3-E2-L4-H3-L5-E3-L6-E4-L7-E5-L8-E6, wherein “H” is a helical domain, “L” is a loop domain, and “E” is a beta strand domain; wherein: (a) the H1 domain is at least 18 or 19 amino acids in length; residue 14 of the H1 domain is Y, D, or E, and residue 18 of the H1 domain is D or E: (b) the E3 domain is at least 6, 7, 8, 9, or 10 amino acids in length and residue 2 of the E3 domain is R; and (c) the E5 domain is at least 10, 11, 12, 13, or 14 amino acids in length and residue 9 of the E5 domain is H or M.

IPC Classes  ?

• C12N 9/02 - Oxidoreductases (1.), e.g. luciferase
• C12N 15/52 - Genes encoding for enzymes or proenzymes
• C12N 15/62 - DNA sequences coding for fusion proteins
• C12Q 1/66 - Measuring or testing processes involving enzymes, nucleic acids or microorganismsCompositions thereforProcesses of preparing such compositions involving luciferase

Abstract

Embodiments of the present disclosure provide methods, systems and non-transitory computer-readable media of determining memory metrics. An example method includes: presenting a plurality of stimuli to a patient; collecting behavioral responses from the patient to the plurality of stimuli; extracting signature, using at least one mathematical model, from the behavioral responses related to memory processes; estimating, using a first computational model, a performance metric for each particular stimulus based on the extracted signature, the performance metric relates to speed of forgetting; and estimating, using a second computational model, memory metric of the patient based on the performance metrics of the stimuli.

IPC Classes  ?

• A61B 5/16 - Devices for psychotechnicsTesting reaction times
• A61B 5/375 - Electroencephalography [EEG] using biofeedback
• G16H 50/70 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for mining of medical data, e.g. analysing previous cases of other patients

Abstract

An instrument includes a head and a main unit. The head includes an inlet and a first outlet on a side of the inlet. The first outlet is elongated along a first axis. The head includes a second outlet on an opposite side of the inlet. The second outlet is elongated along a second axis that forms an angle with the first axis that is between 1 degree and 120 degrees. The head includes a notch configured to receive a filter such that the filter is aligned with the inlet. The main unit includes an impeller that is configured to, when the head is attached to the main unit and the filter is positioned in the notch: move air through the first outlet and against a sample, move air through the second outlet and against the sample, and move air from the sample through the inlet and the filter.

IPC Classes  ?

• G01N 1/24 - Suction devices
• G01N 1/22 - Devices for withdrawing samples in the gaseous state
• B01D 15/08 - Selective adsorption, e.g. chromatography
• G01N 1/28 - Preparing specimens for investigation
• G01N 1/40 - Concentrating samples
• G01J 3/00 - SpectrometrySpectrophotometryMonochromatorsMeasuring colours
• G01N 33/22 - FuelsExplosives

Abstract

The present disclosure is directed to polypeptides capable of cleaving gluten proteins, e.g., gliadins, nucleic acid molecules encoding the same, pharmaceutical compositions comprising the same, and methods of use thereof for treating celiac sprue disease and/or non-celiac gluten sensitivity (NCGS).

IPC Classes  ?

• A61K 38/48 - Hydrolases (3) acting on peptide bonds (3.4)
• C12N 9/52 - Proteinases derived from bacteria

Abstract

The compositions and methods described herein relate to the administration of small molecule inhibitors in combination with a genetic construct expressing KDM4D to promote cardiomyocyte proliferation.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• A61K 31/519 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
• A61K 35/34 - MusclesSmooth muscle cellsHeartCardiac stem cellsMyoblastsMyocytesCardiomyocytes
• A61P 9/10 - Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis

Abstract

Apparatuses, systems, and methods are disclosed for a surgical device with suction capabilities to effectively remove fluid, tissue, and other debris from a surgical site and with a gripper for manipulating tissues and other anatomical structures during surgery. The surgical device also includes a handle having an actuator operable for controlling a position of the gripper and a suction control for adjusting a suctioning level of the device as desired, where the actuator and suction control are arranged on the handle to facilitate individual or simultaneous operation of both mechanisms.

IPC Classes  ?

• A61B 17/29 - Forceps for use in minimally invasive surgery
• A61B 17/00 - Surgical instruments, devices or methods

Abstract

An example method includes detecting, by a receiver of an apparatus at a reception time, a sound signal reflected by an object in an environment. The example method further includes determining, by identifying a frequency of the sound signal, a first angle in a first plane at which the object is disposed; determining a distance between the apparatus and the object based on a time delay between a transmission time of the sound signal and the reception time of the sound signal; and determining a second angle in a second plane at which the object is disposed based on a position of the receiver. A position of the object in the environment is determined based on the first angle, the distance between the apparatus and the object, and the second angle.

IPC Classes  ?

• G01S 15/42 - Simultaneous measurement of distance and other coordinates
• G01S 15/66 - Sonar tracking systems
• G01S 15/89 - Sonar systems specially adapted for specific applications for mapping or imaging
• G01S 7/521 - Constructional features
• G10K 11/34 - Sound-focusing or directing, e.g. scanning using electrical steering of transducer arrays, e.g. beam steering

Abstract

Photonic integrated circuits (PICs) systems and methods for writing PICs are described. In an embodiment, the PICs comprise a substrate; a phase-change material layer comprising a phase-change material disposed on the substrate, wherein the phase-change material comprises an amorphous phase subregion and a crystalline phase subregion; and an oxide layer coating the phase-change material layer. In an embodiment the phase-change material is configured to change phases between a crystalline phase and an amorphous phase upon illumination with light. In an embodiment, the phase-change material layer comprises a low-loss phase-change material layer.

IPC Classes  ?

• G02B 6/12 - Light guidesStructural details of arrangements comprising light guides and other optical elements, e.g. couplings of the optical waveguide type of the integrated circuit kind
• G02F 1/01 - Devices or arrangements for the control of the intensity, colour, phase, polarisation or direction of light arriving from an independent light source, e.g. switching, gating or modulatingNon-linear optics for the control of the intensity, phase, polarisation or colour
• H01L 25/16 - Assemblies consisting of a plurality of individual semiconductor or other solid-state devices the devices being of types provided for in two or more different subclasses of , , , , or , e.g. forming hybrid circuits
• G02B 26/02 - Optical devices or arrangements for the control of light using movable or deformable optical elements for controlling the intensity of light

Abstract

Disclosed are micro-pillar structures that include diamond micro-tips and the preparation of diamond micro-tips. The diamond micro-tips are useful, for example, in chemical analytical measurements such as atom probe tomography.

IPC Classes  ?

• H01J 37/20 - Means for supporting or positioning the object or the materialMeans for adjusting diaphragms or lenses associated with the support
• H01L 21/02 - Manufacture or treatment of semiconductor devices or of parts thereof
• G01N 21/01 - Arrangements or apparatus for facilitating the optical investigation
• G02B 21/24 - Base structure
• H01J 37/073 - Electron guns using field emission, photo emission, or secondary emission electron sources
• H01J 37/075 - Electron guns using thermionic emission from cathodes heated by particle bombardment or by irradiation, e.g. by laser
• H01J 37/077 - Electron guns using discharge in gases or vapours as electron sources
• G01N 23/20025 - Sample holders or supports therefor
• G02B 21/06 - Means for illuminating specimen

Abstract

Polypeptides that bind to asialoglycoprotein receptor (ASGPR), IGF-2R domain 11, IGF-2R, and fusion proteins thereof, that can promote extracellular protein degradation are provided, and methods for their use.

IPC Classes  ?

• C07K 14/00 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof
• C12N 15/09 - Recombinant DNA-technology

Abstract

Polypeptides are provided that include an amino acid sequence at least 50% identical, not including any amino acid insertions at identified insertion sites, to the amino acid sequence selected from the group consisting of SEQ ID NO: 1-52, wherein the polypeptide is a sequence-specific DNA-binding polypeptide, fusion proteins comprising such polypeptides, nucleic acids encoding such polypeptides and fusion proteins, and expression vectors and host cells comprising such nucleic acids.

IPC Classes  ?

• C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
• C12N 15/70 - Vectors or expression systems specially adapted for E. coli

Abstract

Polypeptides are disclosed comprising an (Fc) binding domain, a helical polypeptide monomer, and an oligomer domain, polymers thereof, and uses thereof.

IPC Classes  ?

• A61K 9/51 - Nanocapsules
• C07K 14/32 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from bacteria from Bacillus (G)
• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants

Abstract

Method for nanoparticle-mediated deposition of radiation (NMDR) and targeted radiation therapies using a biodegradable and bioabsorbable iron oxide nanoparticle with a biocompatible coating that is effective to overcome various extra- and intra-cellular barriers and selectively accumulate in solid and metastatic tumors to improve the energy transfer of conventional radiotherapy

IPC Classes  ?

• A61K 33/26 - IronCompounds thereof
• A61K 41/00 - Medicinal preparations obtained by treating materials with wave energy or particle radiation
• A61N 5/10 - X-ray therapyGamma-ray therapyParticle-irradiation therapy
• B82Y 5/00 - Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery

Abstract

An example leadless pacemaker includes a housing including at least one outer surface and at least one energy storage device. The leadless pacemaker also includes at least one electrode coupled to the at least one energy storage device and configured to generate electrical pulses that are delivered to one or more chambers of the heat. The leadless pacemaker further includes at least one piezoelectric device disposed on at least a portion of the outer surface of the housing. The piezoelectric device is electrically coupled to the energy storage device. The piezoelectric device is configured to be generate electrical energy responsive to pressure changes in the heart.

IPC Classes  ?

• A61N 1/378 - Electrical supply
• A61N 1/05 - Electrodes for implantation or insertion into the body, e.g. heart electrode
• A61N 1/375 - Constructional arrangements, e.g. casings

Abstract

Devices, systems, software, and methods are provided for treating bradykinesia with deep brain stimulation (DBS). In particular, DBS is performed with a neural recording device that records brain electrical signals from neural activity associated with intended movement of the subject and automatically adjusts deep brain stimulator settings and/or delivers electrical stimulation to the brain when pre-specified patterns of neural activity associated with the intended movement are detected. Machine learning computational models are used to detect and classify patterns of neural activity associated with intended movement. The neural signatures of "intended movement" are used to assist with DBS programming to determine therapeutic stimulation parameters that boost movement when a patient starts to prepare for movement and during movements but stop when the patient is resting.

IPC Classes  ?

• A61N 1/36 - Applying electric currents by contact electrodes alternating or intermittent currents for stimulation, e.g. heart pace-makers
• A61N 1/05 - Electrodes for implantation or insertion into the body, e.g. heart electrode

Abstract

Method of treating and/or preventing hemorrhagic shock, comprising administering to a subject in need thereof a therapeutically effective amount of a water-soluble polymer having a polymer backbone and pendant groups covalently coupled thereto that associate water on administration to the subject thereby functioning as a plasma volume expander.

IPC Classes  ?

• A61K 47/32 - Macromolecular compounds obtained by reactions only involving carbon-to-carbon unsaturated bonds, e.g. carbomers
• A61K 47/58 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained by reactions only involving carbon-to-carbon unsaturated bonds, e.g. poly[meth]acrylate, polyacrylamide, polystyrene, polyvinylpyrrolidone, polyvinylalcohol or polystyrene sulfonic acid resin
• A61K 9/00 - Medicinal preparations characterised by special physical form
• C08G 18/67 - Unsaturated compounds having active hydrogen

Abstract

Methods of uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are provided. Kits for uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are also provided. The molecules to be labeled may include, but are not limited to, RNAs, cDNAs, DNAs, proteins, peptides, and/or antigens.

IPC Classes  ?

• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
• C12Q 1/6855 - Ligating adaptors

Abstract

Wnt signaling antagonist and agonist compositions and methods for their use are provided.

IPC Classes  ?

• C12N 5/0775 - Mesenchymal stem cellsAdipose-tissue derived stem cells
• C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues

Abstract

inter aliainter alia, are compounds for inhibiting IRE1α and uses thereof.

IPC Classes  ?

• C07D 239/28 - Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings not condensed with other rings having three or more double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to ring carbon atoms
• C07D 241/18 - Oxygen or sulfur atoms
• C07D 277/34 - Oxygen atoms
• A61K 31/506 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
• A61P 29/00 - Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agentsNon-steroidal antiinflammatory drugs [NSAID]
• A61P 3/10 - Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
• A61P 35/00 - Antineoplastic agents

Abstract

The technology disclosed herein relates to compositions and methods for improving the electrophysiological maturity of in vitro-differentiated cardiomyocytes. Media that promote electrophysiological maturation are described, as well as methods for the use of such media and the electrophysiologically matured cardiomyocytes in e.g., transplant and regenerative medicine procedures. The technology described herein is directed to cardiomyocyte maturation medium. Also described herein are associated compositions, kits, and matured cardiomyocytes. The cardiomyocyte maturation medium disclosed here can be used to modulate at least one electrophysiologic property of a cardiomyocyte. The electrophysiologically matured cardiomyocytes can engraft into cardiac tissue and can reduce or inhibit engraftment arrythmia in a subject.

IPC Classes  ?

• C12N 5/077 - Mesenchymal cells, e.g. bone cells, cartilage cells, marrow stromal cells, fat cells or muscle cells
• A61K 35/34 - MusclesSmooth muscle cellsHeartCardiac stem cellsMyoblastsMyocytesCardiomyocytes
• A61P 9/00 - Drugs for disorders of the cardiovascular system

Abstract

inter aliainter alia, are compounds for inhibiting IRE1α and uses thereof.

IPC Classes  ?

• C07D 241/10 - Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings having three double bonds between ring members or between ring members and non-ring members
• C07D 213/04 - Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
• A61K 31/497 - Non-condensed pyrazines containing further heterocyclic rings
• A61P 29/00 - Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agentsNon-steroidal antiinflammatory drugs [NSAID]
• A61P 3/10 - Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
• A61P 35/00 - Antineoplastic agents

Abstract

In some embodiments, a computer-implemented method of processing nanopore signals to detect one or more predetermined features of a feature library in a sample used to generate the nanopore signals is provided. A computing device receives an electrical signal record generated by a flow cell, and breaks the electrical signal record into a plurality of chunks. The computing device generates partial base pair information by basecalling electrical signals of a first chunk of the plurality of chunks, and generates an alignment for the partial base pair information. In response to determining that the alignment corresponds to at least one predetermined feature in the feature library, the computing device executes a feature detection pipeline on the electrical signal record. In response to determining that the alignment does not correspond to at least one predetermined feature in the feature library, the computing device discards the electrical signal record.

IPC Classes  ?

• C12Q 1/6869 - Methods for sequencing
• G01N 33/487 - Physical analysis of biological material of liquid biological material
• G01N 27/447 - Systems using electrophoresis

Abstract

Cyclic ruthenium benzylidene initiators useful for the controlled synthesis of functionalized cyclic macromolecules via ring-expansion metathesis polymerization.

IPC Classes  ?

• C08F 132/04 - Homopolymers of cyclic compounds containing no unsaturated aliphatic radicals in a side chain, and having one or more carbon-to-carbon double bonds in a carbocyclic ring system having no condensed rings having one carbon-to-carbon double bond
• C07F 15/00 - Compounds containing elements of Groups 8, 9, 10 or 18 of the Periodic Table

Abstract

Disclosed herein are methods of making, systems for, and products produced by, additive manufacturing gradient printing. In certain embodiments, at least a portion of the printed product includes a continuous gradient in a particular property (e.g., stiffness).

IPC Classes  ?

• B29C 64/10 - Processes of additive manufacturing
• B29C 64/106 - Processes of additive manufacturing using only liquids or viscous materials, e.g. depositing a continuous bead of viscous material
• B33Y 50/00 - Data acquisition or data processing for additive manufacturing

Abstract

Embodiments of the present disclosure provide compositions and methods for making a genetically modified pluripotent stem cell, wherein the genetically modified pluripotent stem cell lacks cilia. Embodiments of the present disclosure also provide compositions and methods for using the genetically modified pluripotent stem cell to generate genetically modified organoids, wherein the genetically modified organoids lack cilia. Embodiments of the present disclosure provide compositions and methods for making a genetically modified pluripotent stem cell, wherein the genetically modified pluripotent stem cell lacks cilia. Embodiments of the present disclosure also provide compositions and methods for using the genetically modified pluripotent stem cell to generate genetically modified organoids, wherein the genetically modified organoids lack cilia. Knockout Isogenic Gene guide RNA Mutants Controls KIF3A CATATGGACAAACCGGAAC 7 7 KIF3B TTCGCTGTCGGCCCATGAA 3 3 TACACCATGGAAGGAATCCG 4 2

IPC Classes  ?

• G01N 33/50 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing
• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues
• C12N 9/22 - Ribonucleases
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/90 - Stable introduction of foreign DNA into chromosome

Abstract

Various implementations described herein relate to oligonucleotides that specifically bind α4β1. According to some implementations, oligonucleotides are conjugated to a support, a tag, a linker, or a drug. Compositions described herein can be used for diagnosis or treatment of various diseases, such as T cell-mediated autoimmune diseases. An example method includes exposing a solution of cells to the oligonucleotides and isolating cells that express α4β1 from the solution of cells, wherein the cells that express α4β1 are bound to the oligonucleotides. Example methods and compositions described herein can be used for cell selection, diagnostic, therapeutic, or research purposes.

IPC Classes  ?

• G01N 33/569 - ImmunoassayBiospecific binding assayMaterials therefor for microorganisms, e.g. protozoa, bacteria, viruses
• C12N 15/115 - Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith
• G01N 33/53 - ImmunoassayBiospecific binding assayMaterials therefor

Abstract

Escherichia coliE. coliStaphylococcus aureusStaphylococcus aureus. Using multiplexed fluorescent RT-LAMP of heat-lysed specimens, the practicality of deploying such transgenic organisms as an internal control to ascertain sample integrity and assay performance during clinical diagnostic testing is demonstrated. The approach has broad utility for RNA-based bacterial nucleic acid amplification tests, especially point-of-care assays and other applications where nucleic acids are nonspecifically liberated for testing.

IPC Classes  ?

• C12Q 1/6844 - Nucleic acid amplification reactions
• C07K 14/195 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from bacteria
• C07K 16/20 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans from protozoa
• C12N 15/70 - Vectors or expression systems specially adapted for E. coli
• C12N 15/74 - Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora

Abstract

The present disclosure provides methods, systems and devices for guiding, a treatment of a patient experiencing sudden cardiac arrest, by a responder and/or a mechanical CPR device, in accordance with a patient specific treatment protocol. This protocol conditionally implements a pulseless electrical activity protocol when a rhythm classification of an electrocardiogram of the patient is a non-shockable cardiac rhythm with electrical activity and a pulse indication is the absence of the pulse of the patient, or an asystole protocol when the rhythm classification of the electrocardiogram of the patient is a non-shockable cardiac rhythm without electrical activity, or a return of spontaneous circulation protocol when the rhythm classification of the electrocardiogram of the patient is the non-shockable cardiac rhythm with electrical activity and the pulse indication is the presence of the pulse of the patient, or a ventricular fibrillation/ventricular tachycardia protocol when the rhythm classification of the electrocardiogram of the patient is a shockable cardiac rhythm.

IPC Classes  ?

• A61N 1/39 - Heart defibrillators
• A61H 31/00 - Artificial respiration by a force applied to the chestHeart stimulation, e.g. heart massage

Abstract

Systems, modules, methods, and machine-readable storage media for Frequency Angular Resolving (FAR) are described. In an embodiment, the system comprises a transmitter and a receiver. In an embodiment, the transmitter comprises a source of electromagnetic radiation; a driver circuit configured to generate a drive signal at an oscillation frequency; an acousto-optical beam steering device optically coupled with the source of electromagnetic radiation and the driver circuit and configured to emit electromagnetic radiation at an emission angle as a function of the oscillation frequency. In an embodiment, the receiver comprises a radiation sensor optically coupled with the source of electromagnetic radiation. In an embodiment, the system comprises an electro-optic modulator optically coupled to the source of electromagnetic radiation, the electro-optic modulator configured to modulate a frequency of light emitted to the acousto-optical beam steering device.

IPC Classes  ?

• G01S 17/34 - Systems determining position data of a target for measuring distance only using transmission of continuous waves, whether amplitude-, frequency-, or phase-modulated, or unmodulated using transmission of continuous, frequency-modulated waves while heterodyning the received signal, or a signal derived therefrom, with a locally-generated signal related to the contemporaneously transmitted signal
• G01S 7/481 - Constructional features, e.g. arrangements of optical elements
• G01S 7/4912 - Receivers
• G01S 17/89 - Lidar systems, specially adapted for specific applications for mapping or imaging
• G02F 1/33 - Acousto-optical deflection devices

Abstract

Wnt signaling agonist compositions and methods for their use are provided. Wnt signaling agonists of the invention comprise a frizzled binding moiety, which is fused or conjugated to an LRP5 or LRP6 binding moiety.

IPC Classes  ?

• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
• C07K 16/30 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells

Abstract

A method includes capturing, via a camera that is inserted into a cavity, a first image of a surface defining the cavity and compressing the first image, using a compression algorithm, to generate a first feature vector. The method also includes identifying a second feature vector of a plurality of second feature vectors that best matches the first feature vector. The plurality of second feature vectors was generated by compressing second images of the surface using the compression algorithm. The second images were captured prior to insertion of the camera into the cavity and prior to capturing the first image. The method also includes generating, using the second feature vector, output indicating a position and/or an orientation of the camera as the camera captured the first image.

IPC Classes  ?

• G06T 7/73 - Determining position or orientation of objects or cameras using feature-based methods
• A61B 1/00 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopesIlluminating arrangements therefor
• A61B 1/005 - Flexible endoscopes
• A61B 1/045 - Control thereof
• A61B 1/307 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopesIlluminating arrangements therefor for the urinary organs, e.g. urethroscopes, cystoscopes
• G06T 3/40 - Scaling of whole images or parts thereof, e.g. expanding or contracting
• G06T 17/00 - 3D modelling for computer graphics
• G06T 19/00 - Manipulating 3D models or images for computer graphics
• G06V 10/12 - Details of acquisition arrangementsConstructional details thereof
• G06V 10/75 - Organisation of the matching processes, e.g. simultaneous or sequential comparisons of image or video featuresCoarse-fine approaches, e.g. multi-scale approachesImage or video pattern matchingProximity measures in feature spaces using context analysisSelection of dictionaries
• H04N 23/50 - Constructional details
• H04N 23/661 - Transmitting camera control signals through networks, e.g. control via the Internet

Abstract

Acoustic balances configured for weighing in ultrasonic non-contact manipulators, and associated systems and methods are described. In one embodiment, a method for a non-contact acoustic determination of a mass of an object includes capturing the object within an acoustic trap of an acoustic balance. The method also includes, in response to changing at least one acoustic parameter of the acoustic balance, changing an equilibrium position of the object; and in response to changing the equilibrium position of the object, causing the object to oscillate. The method also includes determining a resonant frequency of oscillation of the object; and based on the resonant frequency of oscillation of the object, determining the mass of the object.

IPC Classes  ?

• G01G 5/00 - Weighing apparatus wherein the balancing is effected by fluid action
• G01G 23/01 - Testing or calibrating of weighing apparatus
• G01G 23/06 - Means for damping oscillations, e.g. of weigh-beams
• G01N 29/22 - Investigating or analysing materials by the use of ultrasonic, sonic or infrasonic wavesVisualisation of the interior of objects by transmitting ultrasonic or sonic waves through the object Details

Abstract

Methods of uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are provided. Kits for uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are also provided. The molecules to be labeled may include, but are not limited to, RNAs, cDNAs, DNAs, proteins, peptides, and/or antigens.

IPC Classes  ?

• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
• C12Q 1/6855 - Ligating adaptors

Abstract

The specification provides programmable base editors that are capable of introducing a nucleotide change and/or which could alter or modify the nucleotide sequence at a target site in mitochondrial DNA (mtDNA) with high specificity and efficiency. Moreover, the disclosure provides fusion proteins and compositions comprising a programmable DNA binding protein (e.g., a mitoTALE, a mitoZFP, or a CRISPR/Casp) and double-stranded DNA deaminase that is capable of being delivered to the mitochondria and carrying out precise installation of nucleotide changes in the mtDNA. The fusion proteins and compositions are not limited for use with mtDNA, but also may be used for base editing of any double-stranded target DNA.

IPC Classes  ?

• C12N 9/78 - Hydrolases (3.) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
• C12N 9/22 - Ribonucleases

Abstract

Methods of uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are provided. Kits for uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are also provided. The molecules to be labeled may include, but are not limited to, RNAs, cDNAs, DNAs, proteins, peptides, and/or antigens.

IPC Classes  ?

• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
• C12Q 1/6855 - Ligating adaptors

Abstract

Methods of uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are provided. Kits for uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are also provided. The molecules to be labeled may include, but are not limited to, RNAs, cDNAs, DNAs, proteins, peptides, and/or antigens.

IPC Classes  ?

• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
• C12Q 1/6855 - Ligating adaptors

Abstract

A method of operating a spectrometer includes positioning a crystal analyzer such that a first reciprocal lattice vector corresponding to a first crystal plane of the crystal analyzer is coplanar with a source axis and a detector axis, and performing a first scan by varying a first angle between the source axis and the first crystal plane and varying a second angle between the detector axis and the first crystal plane such that the first angle is substantially equal to the second angle, rotating the crystal analyzer such that a second reciprocal lattice vector corresponding to a second crystal plane of the crystal analyzer is coplanar with the source axis and the detector axis, and performing a second scan by varying the first angle and varying the second angle such that the first angle is substantially equal to the second angle.

IPC Classes  ?

• G01N 23/223 - Investigating or analysing materials by the use of wave or particle radiation, e.g. X-rays or neutrons, not covered by groups , or by measuring secondary emission from the material by irradiating the sample with X-rays or gamma-rays and by measuring X-ray fluorescence
• G01N 23/085 - X-ray absorption fine structure [XAFS], e.g. extended XAFS [EXAFS]
• G01N 23/20008 - Constructional details of analysers, e.g. characterised by X-ray source, detector or optical systemAccessories thereforPreparing specimens therefor
• G01N 23/207 - Diffractometry, e.g. using a probe in a central position and one or more displaceable detectors in circumferential positions

Abstract

Spirocyclic compounds that are KLHDC2 ligands and methods for inhibiting the enzymatic activity of KLHDC2 using the ligands.

IPC Classes  ?

• C07D 498/10 - Spiro-condensed systems
• A61K 31/553 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having at least one nitrogen and at least one oxygen as ring hetero atoms, e.g. loxapine, staurosporine
• C07D 487/10 - Spiro-condensed systems
• C07D 519/00 - Heterocyclic compounds containing more than one system of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring system not provided for in groups or

Abstract

Compositions, kits, and methods for removal of one or more toxins and/or one or more toxin precursors from a subject's digestive system. A composition for ingestion by the subject includes hydrogel particles that include agents encapsulated therein. The agents are configured to reduce local concentrations of one or more toxins and/or one or more toxin precursors from the subject's digestive system with ingestion of the composition. Compositions can include foods or beverages, such as bubble tea beverages, that are functional for removal of toxins and/or precursors from the digestive system.

IPC Classes  ?

• C12N 11/04 - Enzymes or microbial cells immobilised on or in an organic carrier entrapped within the carrier, e.g. gel or hollow fibres
• A23L 33/135 - Bacteria or derivatives thereof, e.g. probiotics
• A61K 35/66 - Microorganisms or materials therefrom
• A61K 9/50 - Microcapsules
• A61P 1/04 - Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
• A61P 13/12 - Drugs for disorders of the urinary system of the kidneys

Abstract

An example neck massaging system includes a housing. The housing is configured to fit around a neck of a wearer. As such, the housing includes an interior region defining an opening configured to receive the neck. The housing also includes a top region and a bottom region opposite the top region. The neck massaging system further includes at least one massager attached to the housing. The massager is positioned on the housing to be adjacent to the interior region which allows the massager to contact the neck. In an example, the massager is positioned on the housing such that the massager contacts the internal jugular vein. The neck massaging system also include at least one actuator operably coupled to the massager. The actuator is configured to move a portion of the massager adjacent to the neck in a direction that generally extends from the top region to the bottom region.

IPC Classes  ?

• A61H 15/00 - Massage by means of rollers, balls, e.g. inflatable, chains, or roller chains
• A61H 9/00 - Pneumatic or hydraulic massage

Abstract

Embodiments of the disclosure are drawn to apparatuses, systems, and methods for 3D microdissection of samples. A microdissection system includes an imaging system and an extraction system. The imaging system may include a fluorescent microscope, and collects a 3D image of a sample. A region of interest is identified in the sample based on the 3D image. The extraction system extracts the identified region of interest. The imaging, identification, and/or extraction may be manual, automated, or a combination thereof.

IPC Classes  ?

• G01N 21/64 - FluorescencePhosphorescence
• G01N 1/08 - Devices for withdrawing samples in the solid state, e.g. by cutting involving an extracting tool, e.g. core bit
• G01N 21/01 - Arrangements or apparatus for facilitating the optical investigation
• G02B 21/36 - Microscopes arranged for photographic purposes or projection purposes
• G06T 7/11 - Region-based segmentation

Abstract

Alpha(v) beta (8) integrin (αvβ8)-selective binding polypeptides and their use for treating or inhibiting cancer or tissue fibrosis are provided, where the polypeptides have an ammo acid sequence at least 50% identical to the amino acid sequence selected from SEQ ID NO: 1-6, not including any amino acid insertions, wherein the polypeptide selectively binds to αvβ8, and wherein: (a) residues 10-12 relative to the reference sequence are RGD (b) residue 13 relative to the reference sequence is F, M, or L; (c) residue 16 relative to the reference sequence is Y or V; and (d) residue 40 relative to the reference sequence is D, E, or P.

IPC Classes  ?

• C07K 14/705 - ReceptorsCell surface antigensCell surface determinants
• A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
• A61P 35/00 - Antineoplastic agents

Goods & Services

Printed educational and training materials in the field of public health Training and educational services in the field of public health screening, treatment and counseling Customizing computer software by adapting open source code in the field of public health, health information systems, and mobile health platforms; quality evaluation services in the field of public health, health information systems, and mobile health platforms Provision of medical services by health care professionals via mobile platforms or telecommunication networks; screening and treatment for cervical cancer; HIV testing, treatment and counseling services; testing, treatment and counseling services in the field of public health; direct provision of voluntary medical male circumcision

Abstract

Examples of systems and methods described herein may receive audio signals from at least one microphone. Example systems and methods may generate noise cancellation signals based at least in part on the audio signals and extract target signals based at least in part on the audio signals using digital neural network processing. Example systems and methods may provide the noise cancellation signals and the target signals from at least one speaker.

IPC Classes  ?

• G10L 25/84 - Detection of presence or absence of voice signals for discriminating voice from noise
• G06N 3/02 - Neural networks
• G10K 11/1752 -
• G10L 21/0216 - Noise filtering characterised by the method used for estimating noise
• G10L 25/51 - Speech or voice analysis techniques not restricted to a single one of groups specially adapted for particular use for comparison or discrimination
• G10L 25/30 - Speech or voice analysis techniques not restricted to a single one of groups characterised by the analysis technique using neural networks

Abstract

The technology described herein is directed to compositions and methods for establishing salivary gland organoid culture. Such salivary gland organoid cultures are derived in vitro from pluripotent stem cells, such as induced pluripotent stems. Also described herein are uses for the salivary gland organoid cultures, including as a model for a salivary gland-associated disease or to screen for an effective therapeutic for a salivary gland-associated disease.

IPC Classes  ?

• A61K 35/545 - Embryonic stem cellsPluripotent stem cellsInduced pluripotent stem cellsUncharacterised stem cells
• C12N 5/00 - Undifferentiated human, animal or plant cells, e.g. cell linesTissuesCultivation or maintenance thereofCulture media therefor
• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues