Abstract

Disclosed are implementations, including a method for medical/clinical monitoring that includes obtaining clinical and physiological measurement data for a patient, and contextual information associated with the patient and representative of location and time at which the clinical and physiological measurement data were obtained, and obtaining clinician behavior data for the clinicians while treating the patient. The method further includes determining intermittently, using an ensemble learning process, based on the measurement data and the contextual information, one of a plurality of medical state prediction models best suited for a current clinical situation associated with the patient. The method additionally includes determining, by the determined medical state prediction model, based on the measurement data and the clinician behavior data, prediction output data representing a medical and/or clinical state trajectory for the patient, and providing notification output data representative of the medical and/or clinical state trajectory for the patient.

IPC Classes  ?

• G16H 50/30 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for calculating health indicesICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for individual health risk assessment
• G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
• G16H 50/70 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for mining of medical data, e.g. analysing previous cases of other patients

Abstract

Multi-target ligands, their synthesis, and their use in treating neurodegenerative diseases are provided.

IPC Classes  ?

• A61K 31/395 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
• A61K 31/167 - Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the nitrogen atom of a carboxamide group directly attached to the aromatic ring, e.g. lidocaine, paracetamol
• A61K 31/426 - 1,3-Thiazoles
• A61K 31/33 - Heterocyclic compounds

Abstract

Provided herein are methods of regulating a subject's preference for fat and/or sugar and methods of screening a substance for an ability to activate a nutrient receptor in a subject's gut.

IPC Classes  ?

• A61K 31/5513 - 1,4-Benzodiazepines, e.g. diazepam
• A61K 31/47 - QuinolinesIsoquinolines
• A61K 31/662 - Phosphorus acids or esters thereof having P—C bonds, e.g. foscarnet, trichlorfon
• A61K 38/22 - Hormones
• A61P 3/02 - Nutrients, e.g. vitamins, minerals

Abstract

Compounds for, and methods of, modeling and treating a neurodegenerative disease, including without limitation frontal temporal dementia (FTD), are provided. An effective dose of a pharmaceutical composition is administered to a patient in need thereof, where the pharmaceutical composition targets at least one muscleblind-like protein (MBNL) binding site on exon 10 of microtubule-associated protein tau (MAPT) to block MBNL binding thereto. The at least one MBNL binding site may be 2 binding sites. The pharmaceutical composition may include the nuclease-inactive dCas13d in complex, with one or more guide RNAs, and/or antisense oligonucleotides (ASOs).

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
• C12N 9/22 - Ribonucleases
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof

Abstract

Disrupting convergence of lytic granules produced by cytotoxic lymphocytes allows non-directional degranulation, which improves and broadens killing efficiency of the cytotoxic cells in pathogenic environments such as when used for cancer therapy. Accordingly, methods of inducing multidirectional degranulation by cytotoxic effector cells in a tumor microenvironment, methods of treating a tumor, and related therapeutic composition are described.

IPC Classes  ?

• A61K 39/00 - Medicinal preparations containing antigens or antibodies
• C12N 5/0783 - T cellsNK cellsProgenitors of T or NK cells
• C12N 9/22 - Ribonucleases
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/90 - Stable introduction of foreign DNA into chromosome

Abstract

The present disclosure provides methods for the generation and purification of proteins and peptides comprising at least one 2-aminoisobutyric acid (Aib) and/or at least one masked form of Aib. The present disclosure further provides masked forms of Aib (e.g., of Formulas I-XVIII) and compositions and cell culture media that include such masked forms of Aib. The present disclosure further provides kits and/or systems for performing the methods described herein.

IPC Classes  ?

• C07D 335/02 - Heterocyclic compounds containing six-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
• C07D 345/00 - Heterocyclic compounds containing rings having selenium or tellurium atoms as the only ring hetero atoms

Abstract

Disclosed are systems, methods, computer program products, and other implementations, including a method for signal detection is disclosed that includes obtaining samples of observation data comprising a signal component produced by a source object, and a noise component, and generating based on at least one of the samples of the observation data, processed by a machine learning template derivation system, a filtering template to separate the signal component from the noise component, with the machine learning template derivation system including one or more trainable layers, and with at least one layer of the one or more trainable layers implementing a respective one of one or more iterations of an unrolled optimization process to determine optimized template parameters for the filtering template. The method further includes applying the filtering template to one or more of the samples of the observation data to obtain the signal component of the observation data.

IPC Classes  ?

• G06N 3/084 - Backpropagation, e.g. using gradient descent

Abstract

The subject matter discloses a metasurface hologram system, including at least a vacuum chamber, where an atomic array is configured to be trapped with various geometries, at least a laser generator, configured to generate one or more incident laser beams, and at least a metasurface hologram, configured to generate trap arrays.

IPC Classes  ?

• G02B 1/00 - Optical elements characterised by the material of which they are madeOptical coatings for optical elements
• G21K 1/00 - Arrangements for handling particles or ionising radiation, e.g. focusing or moderating

Abstract

A 3D printed structure is provided. The structure includes a composition formed from a mixture including an earth component, e.g., naturally occurring soil, subsoil, topsoil, clay, a clay-rich soil, sand, silt, an engineered soil formed of sand and clay, etc.; at least one fiber component, e.g., a bast or leaf fiber, including straw, wheat straw, rice straw, rice husk, reed, hay, hemp, kenaf, banana, sisal, fique, flax, jute, etc.; fluid component, e.g., water, oil, acid, etc.; and at least one additive component, e.g., a bio-based additive such as cellulose, a polypeptide such as gelatin, a polysaccharide such as alginate, guar gum, locust bean gum, chitosan, and xanthan gum, and lime, etc. The mixture includes a weight ratio of about 2-50 parts earth; about 5-50 parts fiber; about 25-80 parts fluid; and about 0-10 parts additive. The mixture can be 3D printed into prefabricated building elements, e.g., block-like geometries, monolithic walls, panels, etc.

IPC Classes  ?

• E04C 2/04 - Building elements of relatively thin form for the construction of parts of buildings, e.g. sheet materials, slabs, or panels characterised by specified materials of concrete or other stone-like materialBuilding elements of relatively thin form for the construction of parts of buildings, e.g. sheet materials, slabs, or panels characterised by specified materials of asbestos cement
• B28B 1/00 - Producing shaped articles from the material
• B33Y 10/00 - Processes of additive manufacturing
• B33Y 70/10 - Composites of different types of material, e.g. mixtures of ceramics and polymers or mixtures of metals and biomaterials
• B33Y 80/00 - Products made by additive manufacturing

Abstract

A method of modifying a nucleotide in a kinase gene on a double-stranded DNA molecule in a mammalian cell, the method comprising introducing to the cell a composition comprising a guide RNA molecule comprising a spacer sequence portion and a fusion protein comprising a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) nuclease and a base editing enzyme.

IPC Classes  ?

• C12N 15/90 - Stable introduction of foreign DNA into chromosome
• C12N 9/22 - Ribonucleases
• C12N 9/78 - Hydrolases (3.) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12Q 1/6876 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes

Abstract

Mechanisms, including systems, methods, and media for establishing authenticity of image content are provided, the methods including: capturing an image using a camera; digitally signing the image using the camera to create a digital signature; and storing a first copy of the image in remote storage with the digital signature. In some embodiments, the image and the digital signature are stored in a blockchain. In some embodiments, the methods further comprise: retrieving a second copy of the image; and determining whether the second copy of the image is authentic based on the digital signature. In some embodiments, the methods further comprise generating an indicator that indicates to a person whether the second copy of the image is authentic. In some embodiments, the methods further comprise storing an indicator of edits made in the edited copy in the blockchain.

IPC Classes  ?

• H04L 9/32 - Arrangements for secret or secure communicationsNetwork security protocols including means for verifying the identity or authority of a user of the system
• H04L 9/00 - Arrangements for secret or secure communicationsNetwork security protocols

Abstract

Transmembrane proteases are necessary for HPIV3 fusion protein cleavage in the human lung. HPIV3 fusion protein cleavage in the human lung is not furin dependent as previously thought, but instead is facilitated by transmembrane proteases, typically targeting TMPRSS2 expression. Serine protease inhibitors may be used in this manner to treat HPIV in a patient. Particular serine protease inhibitors shown to be effective include nafamostat, camostat, aprotinin, and leupeptin. Method of treating HPIV use serine protease inhibitors as treating agents.

IPC Classes  ?

• A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
• A61K 31/132 - Amines, e.g. amantadine having two or more amino groups, e.g. spermidine, putrescine
• A61K 31/245 - Amino benzoic acid types, e.g. procaine, novocaine
• A61P 31/16 - Antivirals for RNA viruses for influenza or rhinoviruses

Abstract

The present disclosure provides methods of treating and preventing trigeminal nerve pain with modulators of oxidative stress (e.g., NRF2 transcription network activators and/or inhibitors of transient receptor potential ankyrin 1 (TRPA1)) and compositions thereof.

IPC Classes  ?

• A61K 33/24 - Heavy metalsCompounds thereof
• A61K 31/26 - Cyanate or isocyanate estersThiocyanate or isothiocyanate esters
• A61K 31/522 - Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
• A61K 31/551 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogens as ring hetero atoms, e.g. clozapine, dilazep
• A61K 31/5685 - Compounds containing cyclopenta[a]hydrophenanthrene ring systemsDerivatives thereof, e.g. steroids not substituted in position 17 beta by a carbon atom, e.g. oestrane, oestradiol substituted in positions 10 and 13 by a chain having at least one carbon atom, e.g. androstane, testosterone having an oxo group in position 17, e.g. androsterone
• A61P 25/04 - Centrally acting analgesics, e.g. opioids

Abstract

This disclosure is related to a method of sequencing a single-stranded DNA using deoxynucleotide polyphosphate analogues and translocation of tags from incorporated deoxynucleotide polyphosphate analogues through a nanopore.

IPC Classes  ?

• C12Q 1/6869 - Methods for sequencing
• C07H 19/10 - Pyrimidine radicals with the saccharide radical being esterified by phosphoric or polyphosphoric acids
• C07H 21/00 - Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
• G01N 33/487 - Physical analysis of biological material of liquid biological material

Abstract

Media for making esophageal organoids, methods of making an esophageal organoid using that media, and esophageal organoids produced by those methods

IPC Classes  ?

• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues
• C12N 5/09 - Tumour cells

Abstract

Disclosed herein are vectors, synthetic antibodies, and methods of producing and using the same, comprising at least one polynucleotide sequence encoding an antibody or fragment thereof, wherein a variable heavy chain domain of the antibody or fragment thereof comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7, and a variable light chain domain of the antibody or fragment thereof comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.

IPC Classes  ?

• C07K 16/10 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
• A61K 39/42 - AntibodiesImmunoglobulinsImmune serum, e.g. antilymphocytic serum viral

Abstract

The present disclosure relates to compositions for increasing acetylated alpha-tubulin levels in peripheral neuronal cells. The present disclosure also relates to the use of tubulin deacetylase inhibitors, or activators of tubulin acetylation for increasing acetylated tubulin levels in the cells. The present disclosure also relates to methods for assessing risk of developing peripheral neuropathy by assessing the levels of acetylated alpha-tubulin. The present disclosure further relates to methods for treating a subject suffering from a peripheral neuropathy using the compositions described herein.

IPC Classes  ?

• A61K 31/437 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
• A61P 25/02 - Drugs for disorders of the nervous system for peripheral neuropathies
• C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
• G01N 33/68 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing involving proteins, peptides or amino acids
• A61K 31/422 - Oxazoles not condensed and containing further heterocyclic rings

Abstract

The present, disclosure relates to anti-SAA antibodies or fragments thereof, such as antibodies against human SAA1 or fragments thereof, that may be used in various therapeutic, prophylactic and diagnostic methods. The present antibodies or fragments thereof may be used to treat hematologic disorders such as acute myeloid leukemia, acute lymphoid leukemia, and myelodysplastic syndrome.

IPC Classes  ?

• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
• C07K 16/00 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies
• A61K 39/395 - AntibodiesImmunoglobulinsImmune serum, e.g. antilymphocytic serum

Abstract

The subject matter described herein relates to a method of treating cancer in a subject in need thereof using a bispecific molecule recognizing two antigen markers of different tissue lineages on the surface of The First Cell.

IPC Classes  ?

• C07K 16/30 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
• A61K 47/68 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
• G01N 33/574 - ImmunoassayBiospecific binding assayMaterials therefor for cancer

Abstract

Treatments and methods for inhibiting late Na current use fibroblast growth factor homologous factor (FHF), an endogenous channel modulator, to inhibit late Na current with high potency. A minimal effector domain is engineered within FHF (the “FHF-inhibiting-X-region” (FixR)) as a peptide inhibitor of late Na current that may be delivered intracellularly, for example as a cell-penetrating peptide, or via viral or plasmid delivery. As a non-limiting example, human adenovirus type 5 may be genetically modified with the sequence 5′-ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAG TCCAACAGCGACCGAGTGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGAC GGGCGCTCC-3′ (SEQ ID NO: 1). As pathophysiological impact of late Na current extends beyond cardiac myocytes to other physiological settings, including neurons of the central and peripheral nervous system and skeletal muscle, these treatments and methods provide potential therapeutic avenues for a range of human ailments, including cardiac conditions, neurological/neuropsychiatric disorders, and skeletal muscle conditions. Neurological/neuropsychiatric disorders include, for example, epilepsy and autism spectrum disorders, pain-related diseases, and myotonia.

IPC Classes  ?

• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61K 38/18 - Growth factorsGrowth regulators
• A61P 9/06 - Antiarrhythmics
• C12N 15/86 - Viral vectors

Abstract

2223222222 desorption decreases the energy costs associated with direct air capture of carbon dioxide.

IPC Classes  ?

• B01D 53/62 - Carbon oxides

Abstract

The method of treating obesity and targeting adipose tissue in a patient may use injection of a polycationic polymer, such as polyamidoamine (PAMAM) generation 3 (P-G3) or a PCL-g-PAMAM Denpol, that when delivered intraperitoneally, selectively targets visceral adiposity due to its high charge density. P-G3 treatment of obese mice inhibits visceral adiposity, increases energy expenditure, prevents obesity, and alleviates associated metabolic dysfunctions. The extracellular matrix of adipose tissue is enriched with glycosaminoglycans, the known biomacromolecules with the strongest negative charge. P-G3 uncouples adipocyte lipid synthesis and storage from adipocyte development, creating adipocytes with normal functions but that are deficient in hypertrophic growth. The visceral fat distribution of P-G3 is further enhanced by modifying P-G3 with cholesterol to form lipophilic nanoparticles, effective in treating obesity. This strategy provides a method to target visceral adiposity, and cationic nanomaterials useful for treating metabolic diseases or for delivery of additional treating agents.

IPC Classes  ?

• A61K 31/785 - Polymers containing nitrogen
• A61K 45/06 - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• A61K 47/28 - Steroids, e.g. cholesterol, bile acids or glycyrrhetinic acid
• A61P 3/04 - AnorexiantsAntiobesity agents

Abstract

Examples of syringe assemblies and sets of components are disclosed for transferring a fluid sample for testing. In some examples, the syringe assembly comprises a housing, a barrel, a plunger reciprocally moveable in the barrel, a narrow tube connected to the barrel, and a metering actuator configured to control movement of the plunger at least in a proximal direction relative to the barrel. The metering actuator is configured to draw a precise microvolume of the fluid sample into a fluid chamber within the syringe assembly. In some examples, while the fluid chamber holds the fluid sample, the distal tip of the narrow tube remains covered, for example inside the housing or a reaction container. The syringe assembly is configured to expel the fluid sample from the fluid chamber into the reaction container.

IPC Classes  ?

• B01L 3/02 - BurettesPipettes

Abstract

Processes, compositions, and apparatus are disclosed. A first process includes providing a cyclopropenimine (CPI). A second process includes providing 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU). The first and second processes include reacting the CPI and DBU, respectively, with carbon dioxide (CO2) in the presence of a nucleophilic species (NuH) and releasing CO2 from products of the reactions by heating to a temperature below about 120° C. A process of direct air capture includes obtaining atmospheric CO2, reacting the CO2 with an organic base having an imine moiety to form a NuCO2− salt, and heating the NuCO2− salt to a temperature below about 120° C. A composition for low-temperature CO2 release includes a tris(amino)cyclopropenium (TAC+) ion and NuCO2−. An apparatus includes a component configured to provide a composition, including a CPI, for capturing CO2 and a component configured to release the CO2 by heating a to a temperature below 120° C.

IPC Classes  ?

• B01J 20/26 - Synthetic macromolecular compounds
• B01D 53/04 - Separation of gases or vapoursRecovering vapours of volatile solvents from gasesChemical or biological purification of waste gases, e.g. engine exhaust gases, smoke, fumes, flue gases or aerosols by adsorption, e.g. preparative gas chromatography with stationary adsorbents
• B01J 20/28 - Solid sorbent compositions or filter aid compositionsSorbents for chromatographyProcesses for preparing, regenerating or reactivating thereof characterised by their form or physical properties
• B01J 20/32 - Impregnating or coating

Abstract

22; and an amount of acid disposed in the container.

IPC Classes  ?

• H01M 10/52 - Removing gases inside the secondary cell, e.g. by absorption
• C25B 1/30 - Peroxides
• C22B 1/00 - Preliminary treatment of ores or scrap
• C22B 3/00 - Extraction of metal compounds from ores or concentrates by wet processes
• C22B 26/12 - Obtaining lithium

Abstract

Provided herein are compositions, methods, and systems for DNA modification. In particular, provided herein are compositions, and systems comprising TnpB-like nuclease-dead repressors (dTnpB/TldRs), dCas12f or dCas12f-like proteins, and/or a TnpB-transposase fusion proteins and methods using thereof.

IPC Classes  ?

• C12N 9/22 - Ribonucleases
• C12N 15/74 - Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora

Abstract

Disclosed are methods of epigenetic mapping with low input capabilities that enable applications to human tissues. The method can also be incorporated with automated/semi-automated capabilities to enable the use epigenetic mapping in prospective clinical trials. The methods comprise shearing the isolated chromatin using focused ultrasonication technology, preferably at least twice, prior to immunoprecipitation of the sheared chromatin and isolation for subsequent DNA analysis.

IPC Classes  ?

• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Abstract

Compositions and methods for treating or preventing nonalcoholic steatohepatitis (NASH) fibrosis, also known as MASH. In one aspect, the disclosed methods relate to targeting a MBOAT7 risk variant, rs641738, in order to increase MBOAT7 expression and down-stream signaling or to silence TAZ. The compositions and methods disclosed herein can be used as disease modifying therapies to enable treatment of NASH fibrosis/MASH and related disorders earlier in disease progression and improve clinical outcomes.

IPC Classes  ?

• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61K 38/45 - Transferases (2)
• C12N 15/86 - Viral vectors

Abstract

Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Also disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using polynucleotides, polypeptides and/or agents which increase efficiency of the “fork reversion and repair” pathway and/or decrease detrimental outcomes such as fork collapse, translesion synthesis and/or gap formation. Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Also disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using polynucleotides, polypeptides and/or agents which increase efficiency of the “fork reversion and repair” pathway and/or decrease detrimental outcomes such as fork collapse, translesion synthesis and/or gap formation. Lastly disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using one or more polynucleotides or polypeptides including but not limited to CHEK1, WEE1, ETAA1, ATRX, BLM, BRCA2, CHD4, DNA2 (DNA2L), EXO1, FANCC, FANCG, FBH1 (FBX018), HLTF (SMARCA3), MCM9, MSH6, POLD3, POLK, RAD51, RAD52, RAD54L, RB1, RECQL, REV3L, RIF1, RNF8, SETD1A, SHPRH, SMARCAL1, TDRD3, TOPBP1, TP53BP1, WRNIP1, XRCC2, WRN, BRCAI, ZRANB3, CDC6, CDT1, POLH, POLI, FANCD2, INO80, FANCB, ASH2L, FAM35A, XRCC3, BRIP1, and RNF168.

IPC Classes  ?

• C12N 5/073 - Embryonic cells or tissuesFoetal cells or tissues
• C12N 9/22 - Ribonucleases
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/90 - Stable introduction of foreign DNA into chromosome

Abstract

Compounds and compositions comprising compounds that modulate histone acyl transferase (HAT). Methods for treating neurodegenerative disorders, conditions associated with accumulated amyloid-beta peptide deposits, Tau protein levels, and/or accumulations of alpha-synuclein as well as cancer by administering a compound that modulates HAT to a subject.

IPC Classes  ?

• A61K 31/395 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
• A61K 31/397 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having four-membered rings, e.g. azetidine
• A61K 31/454 - Non-condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
• A61K 31/435 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
• A61K 31/33 - Heterocyclic compounds

Abstract

Provided are devices that have a distal portion configured to be implanted in a brain of a subject. The distal portion includes one or more emitters configured to emit light in the visible spectrum. The device includes a proximal portion configured to be external to the brain of the subject while the distal portion is implanted, wherein the proximal portion includes at least one waveguide in optical communication with the one or more emitters. The at least one waveguide defines a cross-sectional width less than 500 nm. The at least one waveguide is optionally coupled to a heating element that is optionally configured to adjust a phase of light within the at least one waveguide.

IPC Classes  ?

• G02F 1/01 - Devices or arrangements for the control of the intensity, colour, phase, polarisation or direction of light arriving from an independent light source, e.g. switching, gating or modulatingNon-linear optics for the control of the intensity, phase, polarisation or colour
• A61N 5/06 - Radiation therapy using light

Abstract

The present inhibitory polypeptides/peptides are derived from an envelope (E) protein of a coronavirus (e.g., human coronaviruses such as SARS-CoV-2). The polypeptides/peptides against coronaviruses can be used to treat or prevent infection by a coronavirus in a subject.

IPC Classes  ?

• C07K 14/005 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from viruses
• A61K 38/00 - Medicinal preparations containing peptides
• A61P 31/14 - Antivirals for RNA viruses

Abstract

A cathode active material having a polymer with helical perylene diimide (hPDI) subunits with the side-chains of the helical perylene diimide (hPDI) subunits removed and a method of manufacturing the cathode active material are provided. A rechargeable battery cell with the polymer as a cathode material, a magnesium metal anode, and an ether-based electrolyte.

IPC Classes  ?

• H01M 4/60 - Selection of substances as active materials, active masses, active liquids of organic compounds
• C08G 61/12 - Macromolecular compounds containing atoms other than carbon in the main chain of the macromolecule

Abstract

Provided herein are methods of xenotransplantation, for example, porcine to human transplantation. Also provided herein are extracellular vesicles (“EVs”, e.g., exosomes) and compositions comprising the same. e.g. EVs expressing human CD47. Further provided herein are methods of making EVs and use thereof for xenotransplantation. In some aspects, the methods of xenotransplantation comprise steps of expressing human CD47 on xenografts.

IPC Classes  ?

• A61K 35/12 - Materials from mammalsCompositions comprising non-specified tissues or cellsCompositions comprising non-embryonic stem cellsGenetically modified cells
• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues

Abstract

The present disclosure provides, inter alia, methods for treating neurodegenerative disease including Alzheimer's disease. Methods for restoring retromer complex function in a subject, methods for determining the progression of a neurodegenerative disease in a subject, and in vivo methods for identifying a DNA-binding profile of a dimeric transcription factor complex such as the retromer complex are also provided. Further provided are methods for restoring amyloid precursor protein (APP) homeostasis in a subject in need thereof, methods for restoring tau metabolism in a subject in need thereof, compositions and methods for preventing CREB3L2-ATF4 heterodimerization in a subject using such compositions, and methods for rescuing AP42-induced neuronal cell death in a subject using such compositions.

IPC Classes  ?

• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
• C12Q 1/6874 - Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation [SBH]
• C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
• G01N 33/68 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing involving proteins, peptides or amino acids

Abstract

Described herein is a method for diagnosing cancer in a subject, the method comprising determining methylation status at a plurality of CpG sites within a region of a RAD9 gene in DNA present in a urine sample from the subject, wherein an amount of methylation of the plurality of CpG sites that exceeds a threshold indicates that the subject has cancer. Also described are methods of treatment, methods of assessing a methylation status of DNA present in a urine sample obtained from a human subject, methods of detecting methylation or unmethylation of a RAD9 DNA molecule of a human subject, kits, nucleic acid primers, and compositions.

IPC Classes  ?

• C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

Abstract

The invention relates to methods and pharmaceutical compositions effective for treating, inhibiting, preventing, slowing, or delaying the onset of a neurodegenerative disease in mammals (e.g., humans) via the co-administration of an effective amount of a compound selected from the group consisting of Formula (I), Formula (II), Formula (III) or Formula (IV) or pharmaceutically acceptable salts thereof and a phosphodiesterase inhibitor (e.g., a PDE 5 inhibitor). In certain embodiments, the mammal is a healthy human, or a human experiencing cognitive dysfunction with or without hypertension.

IPC Classes  ?

• A61K 31/407 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with heterocyclic ring systems, e.g. ketorolac, physostigmine
• A61K 31/47 - QuinolinesIsoquinolines
• A61K 31/4985 - Pyrazines or piperazines ortho- or peri-condensed with heterocyclic ring systems
• A61K 31/506 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
• A61K 31/519 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
• A61K 31/53 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with three nitrogens as the only ring hetero atoms, e.g. chlorazanil, melamine
• A61P 25/16 - Anti-Parkinson drugs
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Abstract

A method of treating or preventing glaucoma in a subject is disclosed wherein the method includes administering to the subject a therapeutically effective amount of a therapeutic agent comprising MFSD2A, a derivative of MFSD2A or a modulator of MFSD2A, or a pharmaceutical composition thereof.

IPC Classes  ?

• A61K 45/06 - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Abstract

The present disclosure relates to methods and systems for improved specificity and/or efficiency of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated transposon (CAST) system. In particular, the present disclosure provides systems and methods for increasing specificity and efficiency of CAST system by: modulating TnsC function and abundance; modulating TnsB function and abundance; and influencing CAST target preference.

IPC Classes  ?

• C12N 9/22 - Ribonucleases
• C12N 15/52 - Genes encoding for enzymes or proenzymes
• C12N 15/63 - Introduction of foreign genetic material using vectorsVectorsUse of hosts thereforRegulation of expression
• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
• C07K 14/195 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from bacteria
• C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Abstract

Multiple fluorophores within a sample can be imaged by merging a plurality of beams from different wavelength light sources of excitation light into a single path, directing the excitation light into the sample, and detecting light emitted by the fluorophores within the sample on two different arrays of pixels (e.g., two regions within a single camera sensor chip). The light sources are activated during respective timeslots, and captured image data is processed. For at least one of the timeslots, the processing of the image data comprises using the image data captured using the first array of pixels to detect a presence of a given fluorophore, and using the image data captured using the second array of pixels to detect a presence of a different fluorophore. This arrangement enables a system that includes only N light sources to image more than N fluorophores.

IPC Classes  ?

• G01N 21/64 - FluorescencePhosphorescence

Abstract

The hybrid nanoporous membranes are assembled from inorganic 3D nanospiky particles and polymers, and can be used to filter, capture, and manipulate environmental or biological substances. These materials provide efficient, continuous filtration of ultrasmall biological substances with sizes less than 100 nm while still maintaining air or fluid flow through the materials.

IPC Classes  ?

• B01D 39/20 - Other self-supporting filtering material of inorganic material, e.g. asbestos paper or metallic filtering material of non-woven wires
• A41D 13/11 - Protective face masks, e.g. for surgical use, or for use in foul atmospheres
• B01D 39/16 - Other self-supporting filtering material of organic material, e.g. synthetic fibres

Abstract

An exemplary system, method, and computer-accessible medium for generating diagnostic data associated with a likelihood a patient(s) developing a mental disease(s) can be provided, which can include, for example, providing a visual patterns to the patient(s), receiving electroencephalogram (EEG) information from the patient(s) that can be based on the visual pattern(s); and generating the diagnostic data based on the EEG information.

IPC Classes  ?

• A61B 5/378 - Visual stimuli
• A61B 5/00 - Measuring for diagnostic purposes Identification of persons
• A61B 5/374 - Detecting the frequency distribution of signals, e.g. detecting delta, theta, alpha, beta or gamma waves

Abstract

The present invention describes a fusion protein or peptide conjugate comprising the functional domain of a cardiac-specific short chain amino acid with low affinity for the CaVβ-subunit conjugated. The fusion protein or peptide conjugate upregulates the function of L-type calcium channels in a cell-type dependent manner. In some aspects, the fusion protein is a chimeric genetically encoded enhancer of calcium channels (GeeC) comprising the functional domain of a cardiac-specific short chain amino acid with low affinity for the CaVβ-subunit conjugated to a functionally inert nanobody with high affinity to the CaVβ-subunit. In some aspects, GeeC enables targeted upregulation of CaV1.2/1.3 channels in diverse physiological settings thereby opening new avenues to development of future therapeutics. Methods for creating and administering the GeeC to human and non-human animals for the purposes of experimenting and treating cardiac, neurological, and psychiatric pathologies are also described.

IPC Classes  ?

• C07K 14/705 - ReceptorsCell surface antigensCell surface determinants
• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
• C07K 19/00 - Hybrid peptides
• C12N 15/62 - DNA sequences coding for fusion proteins
• C12N 15/86 - Viral vectors
• A61P 9/00 - Drugs for disorders of the cardiovascular system

Abstract

A method for injecting a therapeutic into the inner ear of a subject comprising providing a microneedle having a sharpened distal tip and a shaft with a maximum outer diameter of about 75 microns to about 150 microns, the microneedle defining an inner lumen with a diameter about 15 microns to about 50 microns; the inner lumen having a curvature near the needle tip such that the lumen opened at the side of the needle proximal the needle tip; the microneedle mounted on a blunt metallic syringe needle; the blunt metallic syringe needle attached to a syringe secured to a micropump; advancing the microneedle into the middle ear space and the perforating the round window membrane (RWM) with the needle tip; extending the needle such that the inner lumen is disposed in the inner ear space; injecting a volume of therapeutic into the inner ear space; and retracting of the microneedle from the RWM.

IPC Classes  ?

• A61M 37/00 - Other apparatus for introducing media into the bodyPercutany, i.e. introducing medicines into the body by diffusion through the skin

Abstract

New therapies for macular degeneration and TTR amyloidosis are provided based on a co-drug that represents a conjugate of two distinct chemical entities as well as co- administration and sequential administration of the two chemical entities. The first component ("selective TTR ligand") is a chemical entity that engages TTR (transthyretin) of the RBP4 (retinol binding protein 4) -TTR complex, which is involved in delivery of retinol to the retina. This component reduces traffic of retinol from circulation to the retina and provides stabilization of TTR tetramers. The second component ("C20-D3-visual- chromophore-producing compound") is a C20-D3-modified retinoid or carotenoid that upon metabolism in a mammal can eventually produce a C20-D3 visual chromophore that represents C20-D3-9-cis-retinaldehyde or C20-D3-11-cis-retinaldehyde in the retina. Deuteration at the C20 position reduces the formation of lipofuscin bisretinoid while other functions (such as providing a precursor for in vivo synthesis of the visual chromophore, 11-cis-retinaldehyde) are not reduced.

IPC Classes  ?

• C07D 213/30 - Oxygen atoms
• A61K 47/55 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds

Abstract

ciscisin vivoin vivo synthesis of the visual chromophore, 11-cis-retinaldehyde) are not reduced.

IPC Classes  ?

• C07D 487/04 - Ortho-condensed systems
• A61K 47/55 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds

Abstract

New therapies for macular degeneration and TTR amyloidosis are provided based on a co-drug that represents a conjugate of two distinct chemical entities as well as co- administration and sequential administration of the two chemical entities. The first component ("bispecific RBP4 /TTR ligand") is a chemical entity that engages TTR ( transthyretin) and RBP4 ( retinol binding protein 4 ) of the RBP4 -TTR complex, which is involved in delivery of retinol to the retina. This component reduces traffic of retinol from circulation to the retina and provides stabilization of TTR tetramers. The second component ("C20-D3-visual-chromophore-producing compound" ) is a C20 -D3 -modified retinoid or carotenoid that upon metabolism in a mammal can eventually produce a C20-D3 visual chromophore that represents C20 -D3- 9-cis-retinaldehyde or C20-D3-11-cis-retinaldehyde in the retina. Deuteration at the C20 position reduces the formation of lipofuscin bisretinoid while other functions ( such as providing a precursor for in vivo synthesis of the visual chromophore, 11-cis-retinaldehyde ) are not reduced.

IPC Classes  ?

• C07D 401/14 - Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
• C07D 403/04 - Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group containing two hetero rings directly linked by a ring-member-to-ring- member bond

Abstract

Provided herein are engineered insulin polypeptide that exhibit disrupted cross-β fibrillation and pharmaceutical compositions comprising the polypeptides. The disclosure also provides are methods for making the insulin polypeptide. Also included are methods of using the pharmaceutical compositions to treat diabetes and hyperglycemia.

IPC Classes  ?

• C07K 14/62 - Insulins
• A61K 38/28 - Insulins

Abstract

inter aliainter alia, compositions and methods for treating premature aging of muscle stem cells to combat myopathy by targeting Cdkn2a.

IPC Classes  ?

• A61K 31/711 - Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
• A61K 45/06 - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Abstract

In one aspect the present invention is directed to mutant NGAL proteins that have the ability to bind to siderophores, such as enterochelin, and to chelate and transport iron, and that are excreted in the urine. Such NGAL mutants, and complexes thereof with siderophores, can be used to clear excess iron from the body, for example in the treatment of iron overload. The NGAL mutants of the invention also have antibacterial activity and can be used in the treatment of bacterial infections, such as those of the urinary tract.

IPC Classes  ?

• C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
• A61K 38/00 - Medicinal preparations containing peptides

Abstract

An animal positioned on a perforated platform can be stimulated in an automated fashion. Images of the animal's paw are captured using a bottom-view camera positioned below the platform. Based on these images, an upwards-pointing tool is moved until it is directly beneath the paw. The animal is then stimulated automatically by moving the tool upwards to contact the paw, then moving it back down to cease the contact. Images of the animal are captured using at least one side-view camera, and these images can be analyzed to ascertain the animal's response to the stimulus.

IPC Classes  ?

• A01K 29/00 - Other apparatus for animal husbandry
• A01K 1/03 - Housing for domestic or laboratory animals
• A01K 15/02 - Training or exercising equipment, e.g. mazes or labyrinths for animals

Abstract

Disclosed are systems and methods for motor control using optimal efficiency reference generation. An electronic controller may determine current values for a motor in a rotational reference frame. Each current value may be associated with a dimension of a set of dimensions of the rotational reference frame. The electronic controller may further determine, based on the current values, a flux linkage value for each of the set of dimensions of the rotational reference frame using an optimization cost function that considers motor speed, copper loss, and core loss. The electronic controller may further determine a target flux linkage value for each of the set of dimensions of the rotational reference frame. The electronic controller may then control a power switching network coupled between a power supply and the motor based on the flux linkage values and the target flux linkage values.

IPC Classes  ?

• H02P 9/10 - Control effected upon generator excitation circuit to reduce harmful effects of overloads or transients, e.g. sudden application of load, sudden removal of load, sudden change of load

Abstract

The present invention relates to methods for regulating prohormone convertase (PC1) and compounds and treatments which increase PC1 levels, for treating Prader-Willi Syndrome (PWS).

IPC Classes  ?

• A61K 31/366 - Lactones having six-membered rings, e.g. delta-lactones
• A61K 31/277 - NitrilesIsonitriles having a ring, e.g. verapamil
• A61K 31/352 - Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. cannabinols, methantheline
• A61K 31/4015 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil having oxo groups directly attached to the heterocyclic ring, e.g. piracetam, ethosuximide
• A61K 31/403 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
• A61K 31/4035 - Isoindoles, e.g. phthalimide
• A61K 31/4162 - 1,2-Diazoles condensed with heterocyclic ring systems
• A61K 31/426 - 1,3-Thiazoles
• A61K 31/437 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
• A61K 31/4375 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having nitrogen as a ring hetero atom, e.g. quinolizines, naphthyridines, berberine, vincamine
• A61K 31/44 - Non-condensed pyridinesHydrogenated derivatives thereof
• A61K 31/454 - Non-condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
• A61K 31/517 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
• A61K 31/519 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
• A61K 31/522 - Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
• A61K 31/5513 - 1,4-Benzodiazepines, e.g. diazepam
• A61K 31/69 - Boron compounds
• A61K 38/00 - Medicinal preparations containing peptides
• A61K 38/08 - Peptides having 5 to 11 amino acids
• A61K 38/095 - OxytocinsVasopressinsRelated peptides
• A61K 45/06 - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• A61P 43/00 - Drugs for specific purposes, not provided for in groups

Abstract

Mechanisms for verifying software are provided, the mechanisms including: identifying a plurality of layers of code of the software including a lowest layer, a middle layer, and a highest layer; generating a low-level specification and an identical refinement proof for each of the plurality of layers using a hardware processor; generating a high-level specification and a lifting refinement proof for each of the plurality of layers; and verifying the software based on the low-level specifications, the identical refinement proofs, the high-level specifications, and the lifting refinement proofs. In some embodiments, one of the low-level specifications is generated using Fixedpoint construction. In some embodiments, one of the high-level specifications is generated by applying a set of transformation rules to one of the low-level specifications.

IPC Classes  ?

• G06F 21/57 - Certifying or maintaining trusted computer platforms, e.g. secure boots or power-downs, version controls, system software checks, secure updates or assessing vulnerabilities

Abstract

An animal positioned on a perforated platform can be stimulated in an automated fashion. Images of the animal's paw are captured using a bottom-view camera positioned below the platform. Based on these images, an upwards-pointing tool is moved until it is directly beneath the paw. The animal is then stimulated automatically by moving the tool upwards to contact the paw, then moving it back down to cease the contact. Images of the animal are captured using at least one side-view camera, and these images can be analyzed to ascertain the animal's response to the stimulus.

IPC Classes  ?

• A61D 7/00 - Devices or methods for introducing solid, liquid, or gaseous remedies or other materials into or onto the bodies of animals
• G03B 17/56 - Accessories
• H04N 23/695 - Control of camera direction for changing a field of view, e.g. pan, tilt or based on tracking of objects
• H04N 23/74 - Circuitry for compensating brightness variation in the scene by influencing the scene brightness using illuminating means

Abstract

Methods and compositions for treating a disease in a subject comprising administering an adoptive cell therapy (ACT) to the subject, the ACT comprising delivering a modified lymphocyte comprising a modified T cell receptor (TCR) or a chimeric antigen receptor (CAR); at least one inactivated endogenous TCRα chain allele; and at least one inactivated endogenous TCRβ chain allele.

IPC Classes  ?

• C07K 14/725 - T-cell receptors
• C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells

Abstract

The present disclosure provides systems and methods for isolation of nucleic acids. In particular, provided herein are nanopore-based or substrate-based sequencing systems and methods of use thereof for isolation of desired nucleic acids from a mixed library containing both accurate and inaccurate strands.

IPC Classes  ?

• C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
• C12Q 1/6869 - Methods for sequencing
• G16B 30/00 - ICT specially adapted for sequence analysis involving nucleotides or amino acids

Abstract

The present disclosure provides, inter alia, a recombinant engineered deubiquitinase (DUB) and methods for treating or ameliorating an inherited ion channelopathy, such as long QT syndrome, Brugada syndrome, or cystic fibrosis, in a subject. Further provided are methods for screening mutations causing such inherited ion channelopathies for a trafficking-deficient mutation that is treatable by the recombinant engineered DUB disclosed herein.

IPC Classes  ?

• C12N 9/64 - Proteinases derived from animal tissue, e.g. rennin
• A61K 38/00 - Medicinal preparations containing peptides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

Abstract

The present disclosure provides, inter alia, a recombinant engineered deubiquitinase (DUB) and methods for treating or ameliorating an inherited ion channelopathy, such as long QT syndrome, Brugada syndrome, or cystic fibrosis, in a subject. Further provided are methods for screening mutations causing such inherited ion channelopathies for a trafficking-deficient mutation that is treatable by the recombinant engineered DUB disclosed herein.

IPC Classes  ?

• C12N 9/64 - Proteinases derived from animal tissue, e.g. rennin
• A61K 38/00 - Medicinal preparations containing peptides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

Abstract

A method for treating pancreatic cancer, comprising administering to a subject in need thereof a therapeutically effective amount DMPatA, or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount Class 1 HDAC inhibitor selected from the group consisting of romidepsin, entinostat, and chidamide.

IPC Classes  ?

• A61K 31/426 - 1,3-Thiazoles
• A61K 38/15 - DepsipeptidesDerivatives thereof
• A61K 9/08 - Solutions
• A61P 35/00 - Antineoplastic agents
• G01N 33/574 - ImmunoassayBiospecific binding assayMaterials therefor for cancer

Abstract

Methods to prevent, inhibit or treat a neurodegenerative disease, e.g., one having protein aggregates, as well as compositions useful in that regard, are provided.

IPC Classes  ?

• A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
• A61K 9/127 - Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
• A61K 38/17 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Abstract

The disclosed subject matter provides systems and methods for predicting a spontaneous preterm birth based on transvaginal ultrasound images of a subject. An example method can include providing a preterm birth prediction model, obtaining one or more transvaginal ultrasound images of the subject, each including cervical features, determining measurements of a plurality of cervical structure features from the one or more ultrasound images, assessing, using the preterm birth prediction model, cervical health of the subject based on the measurements of the plurality of cervical structure features, and calculating the spontaneous preterm birth risk based on the assessed cervical health, using the preterm birth prediction model.

IPC Classes  ?

• A61B 8/12 - Diagnosis using ultrasonic, sonic or infrasonic waves in body cavities or body tracts, e.g. by using catheters
• A61B 5/00 - Measuring for diagnostic purposes Identification of persons

Abstract

The invention discloses PU7-1, pharmaceutical compositions comprising PU7-1, and methods of treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of PU7-1.

IPC Classes  ?

• A61K 31/517 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
• A61P 35/00 - Antineoplastic agents
• C07D 401/14 - Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings

Abstract

Disclosed herein are methods of treating and/or prophylaxis of a disease or condition associated with cellular stress granule formation in a mammal via administration of small molecule compounds. Also disclosed herein are chemical compounds effective in treating diseases or conditions associated with aberrant cellular stress responses and/or stress granule formation.

IPC Classes  ?

• A61K 31/41 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which is nitrogen, e.g. tetrazole
• A61K 31/44 - Non-condensed pyridinesHydrogenated derivatives thereof
• A61K 31/519 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
• A61K 31/69 - Boron compounds
• G01N 33/68 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing involving proteins, peptides or amino acids

Abstract

CAR Tregs and Tregs are provided which are both conversion-resistant and condition-resistant. The Treg cells are engineered such that they are deficient in or substantially devoid of a cell-surface marker or antigen.

IPC Classes  ?

• A61K 39/00 - Medicinal preparations containing antigens or antibodies
• A61P 37/06 - Immunosuppressants, e.g. drugs for graft rejection
• C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
• C12N 5/0783 - T cellsNK cellsProgenitors of T or NK cells
• C12N 9/22 - Ribonucleases
• C12N 15/11 - DNA or RNA fragmentsModified forms thereof
• C12N 15/90 - Stable introduction of foreign DNA into chromosome

Abstract

The disclosed subject matter relates to a photonically integrated atomic tweezer clock. An example atomic tweezer clock can include a laser system, a holographic metasurface, a vacuum system, and a cold atoms source, wherein the holographic metasurface generates an optical tweezer array, and the atoms are trapped by the optical tweezer array in the vacuum system for generating an atomic tweezer clock. In certain embodiments, the laser system is integrated with frequency combs in chip-scale to ensure compactness and robustness.

IPC Classes  ?

• G21K 1/00 - Arrangements for handling particles or ionising radiation, e.g. focusing or moderating
• G04F 5/14 - Apparatus for producing preselected time intervals for use as timing standards using atomic clocks

Abstract

An ultrasound phased array integrated in flexible CMOS technology is provided. The CMOS IC chip is fabricated through various chip-thinning techniques, resulting in mechanical flexibility, robustness, and minimized mechanical loading for the piezoelectric transducers. The ultrasound phased array CMOS patch can allow for the generation of high intensity focal regions for maximum penetration in regions of interest.

IPC Classes  ?

• A61B 8/00 - Diagnosis using ultrasonic, sonic or infrasonic waves
• A61N 7/00 - Ultrasound therapy

Abstract

Provided is a nebulizer device, the device including: a housing comprising a mouthpiece and a cover movable between a first position and a second position, the nebulizer device being configured to contain therein a liquid therapeutic formulation; and a vibratory nebulizer being disposed inside the housing and being in fluid communication with the liquid therapeutic formulation and the mouthpiece, the vibratory nebulizer optionally comprising a mesh, the vibratory nebulizer configured to nebulize the liquid therapeutic formulation into aerosolized particles in a range of 3 to 35 microns, optionally from about 10 to about 35 microns, and the device configured such that when the cover is in the first position the cover covers the mouthpiece and inactivates the nebulizer and when the cover is in the second position the mouthpiece is exposed to a user.

Abstract

Salmonella typhimuriumSalmonella typhimurium comprising a first heterologous nucleic acid encoding a first polypeptide that causes bacterial lysis, a second heterologous nucleic acid encoding a second polypeptide that causes vacuolar lysis, and a third heterologous nucleic acid encoding a virus.

Abstract

Introduce into a reactor a polyurethane having a benzylic linkage. In one aspect, induce a chemical reduction through a reducing agent and a catalyst to depolymerize the polyurethane having the benzylic linkage. In another aspect, introduce hydrogen bromide into the reactor, and react the polyurethane with the hydrogen bromide to recover constituents of the polyurethane via acid-catalyzed bromine-substitution to cleave the benzylic linkage of the polyurethane.

IPC Classes  ?

• C08J 11/16 - Recovery or working-up of waste materials of polymers by chemically breaking down the molecular chains of polymers or breaking of crosslinks, e.g. devulcanisation by treatment with inorganic material

Abstract

Systems, methods and devices for profiling phenotypes of cells, and associated methods for identifying or predicting drug mechanism of action, discovering drug candidates with novel mechanisms of actions, differential subpopulation responses to drugs, and novel IR vibrational probes.

Abstract

Disclosed herein is a computational algorithm that statistically infer a PPR code (preference of a PPR motif for a nucleotide base) while matching PPR proteins with their targets accurately without requiring experimental pairing information. From comprehensive lists of PLS-type PPR proteins and editing sites from more than 1500 PPRs, the algorithm derived a quantitative code including novel amino acid combinations in key positions that confer high specificity. For example, the predicted targets suggests that the recently identified DYW:KP domain is unequivocally responsible for the poorly characterized reverse U-to-C editing.

Abstract

Methods for generating mature neurons differentiated from pluripotent stem cells, such as to facilitate the study of late-onset neurodegenerative disease, are disclosed. The methods include overexpressing the splicing factor muscleblind like splicing regulator 2 (Mbnl2) in cortical neurons. In some aspects, the method further comprises overexpressing RNA binding fox-1 homolog 1 (Rbfox1) and/or reducing expression of polypyrimidine tract binding proteins PTBP1/2. The methods also include accelerated derivation of mature neuron and generation of a tau pathology model. Also disclosed are constructs and compositions for accelerated derivation of mature neuron and/or generation of a tau pathology model.

IPC Classes  ?

• C12N 5/0793 - Neurons
• C07K 14/47 - Peptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from animalsPeptides having more than 20 amino acidsGastrinsSomatostatinsMelanotropinsDerivatives thereof from humans from vertebrates from mammals
• C12N 15/867 - Retroviral vectors

Abstract

Provided is a building material, comprising: a base material and an amount of aragonite, the aragonite optionally present at up to about 60 wt% of the total weight of the base material and the aragonite. The base material can include any one or more of a cementitious material, a clay, a biopolymer, gypsum, and lime. The disclosed materials are useful in manufacturing processes, including additive manufacturing and other construction processes.

IPC Classes  ?

• C01F 11/18 - Carbonates
• C04B 7/345 - Hydraulic cements not provided for in one of the groups

Abstract

Provided herein are heterocyclic derivative compounds and pharmaceutical compositions comprising said compounds that are useful for the treatment of retinal binding protein (RBP4) related diseases, such as obesity and the like.

IPC Classes  ?

• A61K 31/4545 - Non-condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
• A61K 9/00 - Medicinal preparations characterised by special physical form
• A61K 31/4985 - Pyrazines or piperazines ortho- or peri-condensed with heterocyclic ring systems
• A61K 31/519 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
• A61K 31/5365 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and at least one oxygen as the ring hetero atoms, e.g. 1,2-oxazines ortho- or peri-condensed with heterocyclic ring systems
• A61K 31/5383 - 1,4-Oxazines, e.g. morpholine ortho- or peri-condensed with heterocyclic ring systems
• A61P 3/04 - AnorexiantsAntiobesity agents
• A61P 3/10 - Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics

Abstract

A plurality of modules are simultaneously positioned at locations that correspond to different angiosomes. Each of these modules has a front surface shaped and dimensioned for contacting a person's skin, a plurality of different-wavelength light sources aimed in a forward direction, and a plurality of light detectors aimed to detect light arriving from in front of the front surface. Each module is supported by a support structure (e.g., a strap or a clip) that is shaped and dimensioned to hold the front surface adjacent to the person's skin at a respective position. Perfusion in each of the angiosomes is monitored using these modules, and the surgeon can rely on this information to guide his or her intervention.

IPC Classes  ?

• A61B 5/026 - Measuring blood flow
• A61B 5/00 - Measuring for diagnostic purposes Identification of persons
• A61B 5/02 - Detecting, measuring or recording for evaluating the cardiovascular system, e.g. pulse, heart rate, blood pressure or blood flow
• A61B 5/021 - Measuring pressure in heart or blood vessels
• A61B 5/022 - Measuring pressure in heart or blood vessels by applying pressure to close blood vessels, e.g. against the skinOphthaldynamometers
• A61B 5/0225 - Measuring pressure in heart or blood vessels by applying pressure to close blood vessels, e.g. against the skinOphthaldynamometers the pressure being controlled by electric signals, e.g. derived from Korotkoff sounds
• A61B 5/0245 - Measuring pulse rate or heart rate using sensing means generating electric signals
• A61B 5/1455 - Measuring characteristics of blood in vivo, e.g. gas concentration or pH-value using optical sensors, e.g. spectral photometrical oximeters

Abstract

Disclosed herein is a biochip with a plurality of endothelial cells (e.g., Schlemm's canal cells) having a plurality of pores (e.g., transcellular pores) and methods of making and using the same.

IPC Classes  ?

• B01L 3/00 - Containers or dishes for laboratory use, e.g. laboratory glasswareDroppers
• C12N 5/00 - Undifferentiated human, animal or plant cells, e.g. cell linesTissuesCultivation or maintenance thereofCulture media therefor
• C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues

Abstract

Systems, methods, and devices for generating tunable low frequency signals, such as microwave and radiofrequency signals are disclosed. A first waveguide in optical communication with a first ring resonator can be configured to receive a light input and generate frequencies via optical parametric oscillation. A second waveguide with second ring resonator can receive the frequencies and optically synchronize the frequencies via optical frequency division to generate a low frequency signal. One or more heating elements can be connected to each ring resonator to tune the resonators and reduce noise associated with the low frequency signal.

IPC Classes  ?

• G02F 1/39 - Non-linear optics for parametric generation or amplification of light, infrared, or ultraviolet waves
• G02F 1/01 - Devices or arrangements for the control of the intensity, colour, phase, polarisation or direction of light arriving from an independent light source, e.g. switching, gating or modulatingNon-linear optics for the control of the intensity, phase, polarisation or colour

Abstract

A system may mitigate leakage currents in charging stations for electric vehicles. The system may include a bank of one or more parallel capacitors per phase electrically coupled to an AC voltage source, wherein a neutral point of the one or more parallel capacitors is electrically coupled to a DC ground; a bank of one or more inductors per phase electrically coupled to the one or more parallel capacitors, wherein each inductor is in series with and downstream from one capacitor; a rectifier electrically coupled to and downstream from the one or more parallel inductors, wherein the rectifier converts the AC voltage source to a DC voltage for supply to a battery; a DC bus electrically coupled to the rectifier; and a controller, wherein the controller is configured to mitigate leakage currents by controlling a voltage of at least one of the bank of one or more parallel capacitors.

IPC Classes  ?

• B60L 53/30 - Constructional details of charging stations
• H02J 7/06 - Regulation of the charging current or voltage using discharge tubes or semiconductor devices
• H02M 1/44 - Circuits or arrangements for compensating for electromagnetic interference in converters or inverters
• H02M 3/158 - Conversion of DC power input into DC power output without intermediate conversion into AC by static converters using discharge tubes with control electrode or semiconductor devices with control electrode using devices of a triode or transistor type requiring continuous application of a control signal using semiconductor devices only with automatic control of output voltage or current, e.g. switching regulators including plural semiconductor devices as final control devices for a single load
• H02M 7/219 - Conversion of AC power input into DC power output without possibility of reversal by static converters using discharge tubes with control electrode or semiconductor devices with control electrode using devices of a triode or transistor type requiring continuous application of a control signal using semiconductor devices only in a bridge configuration

Abstract

Compositions and methods for treating neurodegenerative disease or neuroinflammatory condition in a subject with HuB-effector agents.

Abstract

The present disclosure relates to a method for generating a training set based on a first set of images and a second set of images, each image having a respective observational environment and a respective feature set. The method includes (a) obtaining, by a generator module, the first set of images and the second set of images; (b) extracting, by the generator module, one or more feature sets from each image in the first set of images; (c) extracting, by the generator module, one or more respective observational environments from each image in the second set of images; (d) deriving, by an encoder module, one or more latent representations from the one or more feature sets extracted from one or more images in the first set of images; (e) deriving, by the encoder module, one or more style codes from the one or more respective observational environment extracted from one or more images in the second set of images; (f) generating, by the generator module, an interventional training distribution having samples including each respective one or more style codes and each one or more latent representations; and, (g) storing, by the generator module, the interventional training distribution training set.

Abstract

The disclosed subject matter provides systems and methods for calculating a right ventricular (RV) volume. An example system can include one or more processors configured to receive a testing image, tokenize a categorical input and a numerical input from the testing image, forward the categorical input and the numerical input to a cascaded transformer layer, transform the categorical input and the numerical input into an embedding, transform the embedding into a classification token, and provide a measurement of RV of the testing image based on the CLS token.

IPC Classes  ?

• A61B 5/346 - Analysis of electrocardiograms
• A61B 5/00 - Measuring for diagnostic purposes Identification of persons
• A61B 8/08 - Clinical applications
• G06V 10/80 - Fusion, i.e. combining data from various sources at the sensor level, preprocessing level, feature extraction level or classification level
• G06V 10/82 - Arrangements for image or video recognition or understanding using pattern recognition or machine learning using neural networks
• G16H 30/40 - ICT specially adapted for the handling or processing of medical images for processing medical images, e.g. editing
• G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
• G06T 7/33 - Determination of transform parameters for the alignment of images, i.e. image registration using feature-based methods
• G06T 9/00 - Image coding
• G06V 40/10 - Human or animal bodies, e.g. vehicle occupants or pedestriansBody parts, e.g. hands

Abstract

Exemplary systems, methods, and computer-accessible medium are provided that can facilitate an electrogram feature set associated with an object. Thus, the exemplary systems, methods, and computer-accessible medium can be provided that can receive image information for the object and determine at least one characteristic of at least one portion of the object based on the image information and a time series voltage trace. The exemplary systems, methods, and computer-accessible medium are provided that can localize a reentry isthmus. Thus, exemplary systems, methods, and computer-accessible medium can be provided that can receive image information for an object and generate a probability map for the object based on a plurality of characteristics related to an electrogram feature set, and using the image information.

IPC Classes  ?

• G06T 7/00 - Image analysis
• A61B 18/00 - Surgical instruments, devices or methods for transferring non-mechanical forms of energy to or from the body
• A61B 18/14 - Probes or electrodes therefor

Abstract

The invention relates to a bioactive lipid (BAL) composition comprising one or more hydrocarbon-derivatized fatty acids (FAs), which can be an oxygenated, halogenated, amino, amide, nitro, cyano, furanoid, nitroso, isonitrile, or O-substituted derivative of the hydrocarbon-derivatized FA, which are bound to a molecular backbone. In some embodiments, the BALs comprise a specialized pro-resolving mediator (SPMs), eicosanoid, prostanoid, prostaglandin, or endocannabinoid (eCBs) and optionally further comprise omega-3 (n-3) FAs and/or omega-6 (n-6) FAs. In general, the BALs are conjugated to a molecular backbone, preferably a five- or six-carbon monosaccharide, or glycerol. The compositions can be formulated as an emulsion. Preferred BALs can be selected by their performance in one or more cellular assays or animal models. These compositions are useful for tissue or organ protection in a patient, for example in stroke, ischemia, traumatic injury, a neurodegenerative disorder, or organ injury and/or transplant.

IPC Classes  ?

• A61K 47/54 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
• A61K 47/59 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
• A61K 47/60 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
• A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Abstract

A minimally invasive device, containing a pressure channel, camera, and optical fiber imaging probe, to measure the stiffness of tissues in vivo and ex vivo is disclosed. The device is inserted into a patient and navigated to a tissue of interest, where stiffness is evaluated by applying suction and measuring the elongation or by applying compression force and measuring the compression of the tissue. Biopsies can be taken for further analysis, or tissue can be removed using an ablation laser. Small fluorescent molecules or therapeutics can also be delivered for improved visualization and targeted treatment. As such, this technology may be used to evaluate the stiffness of biomaterials as well as tissues and organs that are difficult to access, allowing for simultaneous diagnosis, treatment, and excision of diseased tissues.

IPC Classes  ?

• A61B 5/00 - Measuring for diagnostic purposes Identification of persons
• A61B 5/08 - Measuring devices for evaluating the respiratory organs
• A61B 18/24 - Surgical instruments, devices or methods for transferring non-mechanical forms of energy to or from the body by applying electromagnetic radiation, e.g. microwaves using laser the beam being directed along or through a flexible conduit, e.g. an optical fibreHand-pieces therefor with a catheter
• A61B 90/00 - Instruments, implements or accessories specially adapted for surgery or diagnosis and not covered by any of the groups , e.g. for luxation treatment or for protecting wound edges

Abstract

The present invention provides methods for using an anionic manganese oxide (MnO) nanoparticle-based nucleic acid scavenger to (1) inhibit viral infection of cells, (2) reduce or inhibit a viral infection of a subject, and (3) reduce viral infection induced inflammation in a subject.

IPC Classes  ?

• A61K 33/32 - ManganeseCompounds thereof
• A61K 47/69 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
• A61P 37/06 - Immunosuppressants, e.g. drugs for graft rejection

Abstract

Pancreatic ductal adenocarcinoma (PDAC) has abundant immunosuppressive regulatory T cells (Tregs) which contribute to a tumor microenvironment that is resistant to immunotherapy. Tregs in the PDAC tissue, but not those in the spleen, express the αvβ5 integrin in addition to neuropilin-1 (NRP-1), which makes them susceptible to the iRGD tumor-penetrating peptide that targets αv integrin- and NRP1-positive cells. As a result, long-term treatment of PDAC mice with iRGD leads to a tumor-specific decrease of Tregs and improved efficacy of an immune checkpoint blockade. αvβ5 integrin+ Tregs are induced from both naïve CD4+ T cells and natural Tregs upon T cell receptor stimulation, and represent a highly immunosuppressive subpopulation of CCR8+ Tregs. This study identifies αvβ5 integrin as a marker for activated tumor-resident Tregs that can be expanded to achieve tumor-specific Treg depletion to improve anti-tumor immunity for PDAC management.

Abstract

The invention provides for methods for treating a hair loss disorder in a subject by administering a Janus Kinase/Signal Transducers and Activators of Transcription inhibitor.

IPC Classes  ?

• A61Q 7/00 - Preparations for affecting hair growth
• A61K 8/41 - Amines
• A61K 8/49 - Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
• A61K 8/64 - ProteinsPeptidesDerivatives or degradation products thereof
• A61K 31/137 - Arylalkylamines, e.g. amphetamine, epinephrine, salbutamol, ephedrine
• A61K 31/277 - NitrilesIsonitriles having a ring, e.g. verapamil
• A61K 31/407 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with heterocyclic ring systems, e.g. ketorolac, physostigmine
• A61K 31/437 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
• A61K 31/506 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
• A61K 31/519 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
• A61K 31/52 - Purines, e.g. adenine
• A61K 31/529 - PyrimidinesHydrogenated pyrimidines, e.g. trimethoprim forming part of bridged ring systems
• A61K 31/5377 - 1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
• A61K 31/553 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having at least one nitrogen and at least one oxygen as ring hetero atoms, e.g. loxapine, staurosporine
• A61K 31/63 - Compounds containing para-N-benzene- sulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonohydrazide
• A61K 31/7052 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
• A61K 31/713 - Double-stranded nucleic acids or oligonucleotides

Abstract

The present disclosure provides, inter alia, a recombinant engineered deubiquitinase (DUB) and methods for treating or ameliorating an inherited ion channelopathy, such as long QT syndrome, Brugada syndrome, or cystic fibrosis, in a subject. Further provided are methods for screening mutations causing such inherited ion channelopathies for a trafficking-deficient mutation that is treatable by the recombinant engineered DUB disclosed herein.

IPC Classes  ?

• C12N 9/64 - Proteinases derived from animal tissue, e.g. rennin
• A61K 38/00 - Medicinal preparations containing peptides
• C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

Abstract

A method for practicing precision medicine comprising providing, to a blockchain platform, each of clinical data and genetic data, providing the blockchain platform, the blockchain platform having a first data structure comprising clinical data and a second data structure comprising genetic data, harmonizing the first and second data structures, creating at least one cohort based on the harmonized first and second data structures, and identifying at least one relationship between the clinical data and the genetic data in each of the at least one cohort.

IPC Classes  ?

• G16H 50/70 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for mining of medical data, e.g. analysing previous cases of other patients
• G06F 16/22 - IndexingData structures thereforStorage structures
• G06F 16/23 - Updating
• G06F 16/245 - Query processing

Abstract

A culture vessel configured for culturing biological cells including a body being configured to be rotated about an axis of rotation, the body including one or more helical conduit configured to receive a fluid and extending along an exterior surface of the body, the body defining a reservoir configured to receive the fluid, and the body defining a first aperture and a second aperture each in communication with the helical conduit and the reservoir and configured for passage of the fluid, and the culture vessel further optionally including a support being received within the reservoir of the body, the support including a permeable membrane configured to accommodate biological cells, wherein the helical conduit of the body is configured to facilitate movement of the fluid between the first aperture and the second aperture of the body during rotation of the body.

IPC Classes  ?

• A01N 1/02 - Preservation of living parts
• G01N 1/40 - Concentrating samples
• A61B 10/00 - Instruments for taking body samples for diagnostic purposesOther methods or instruments for diagnosis, e.g. for vaccination diagnosis, sex determination or ovulation-period determinationThroat striking implements

Abstract

Methods of treating or preventing elevated intraocular pressure in a subject are disclosed, the methods including administering to the subject a therapeutically effective amount of nicotinamide or a derivative or analog of nicotinamide, or a pharmaceutical composition thereof, wherein the subject is not afflicted with glaucoma.

IPC Classes  ?

• A61K 31/395 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
• A61K 31/435 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
• A61K 31/166 - Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the carbon atom of a carboxamide group directly attached to the aromatic ring, e.g. procainamide, procarbazine, metoclopramide, labetalol
• A61K 31/33 - Heterocyclic compounds

Abstract

Described is use of biomarkers found in maternal mid-gestation (MMG) and cord blood (CB) plasma for early identification of children with autism spectrum disorder (ASD) or at risk for ASD. Using these biomarkers, newborns and infants with ASD or at high risk of ASD can be identified and interventions for ASD, which have been shown to be effective early in life, can be provided to a child as young as a newborn.

IPC Classes  ?

• G16H 50/30 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for calculating health indicesICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for individual health risk assessment
• G01N 33/48 - Biological material, e.g. blood, urineHaemocytometers
• G01N 33/68 - Chemical analysis of biological material, e.g. blood, urineTesting involving biospecific ligand binding methodsImmunological testing involving proteins, peptides or amino acids
• G01N 30/72 - Mass spectrometers
• G16H 20/70 - ICT specially adapted for therapies or health-improving plans, e.g. for handling prescriptions, for steering therapy or for monitoring patient compliance relating to mental therapies, e.g. psychological therapy or autogenous training
• G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data miningICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems

Abstract

Compositions, methods of production, methods of use, and systems for use of a humidity swing sorbent can have applications in the capture of carbon dioxide or other target chemicals from the air or other gas streams. The compositions, methods, and systems can use a humidity swing sorbent that includes a sorbent carrier layer of an oxide nanoparticle material or a nanoporous material, and a capture layer, the capture layer comprising a set of neutral ionic pairs with at least one cation and at least one anion, wherein the set of neutral ionic pairs are spatially distributed on scaffolding of the oxide material such that the anions of each neutral ionic pair is spaced for formation of a hydration shell around each anion, wherein the hydration shell around the anion is a carbon dioxide adsorption site.

Abstract

A copper metal (Cu022) via oxidative leaching with a cerium (Ce(IV)) redox couple. Ce4+22S generation, reducing overall costs while increasing yields.

Abstract

Enriched metal concentrates and metal products are produced at standard temperature and pressure via sequential treatment of metal concentrates with chemical reducers such as vanadium (V(II)) and chromium (Cr(II)) and chemical oxidizers (Ce(IV)). Naturally occurring ores such as pentlandite, pyrrhotite, chalcopyrite, etc. include concentrations of iron and sulfur that are preferentially leached via reaction with the chemical reducers. The resulting products are enriched for target metals, such as nickel, and can be further reacted with chemical oxidizers to recover metal leachates. Additional ferric iron ion leaching can isolate high concentrations of copper metal products as well. Lower-quality minerals can be converted to higher-quality concentrates as demand for higher-quality feedstocks increases yet the available of those feedstocks decreases. The chemical reducers and oxidizers can be replenished electrochemically for reuse with additional metal concentrates, decreasing the overall costs and material wastes.

IPC Classes  ?

• C22B 3/40 - Mixtures
• C22B 15/00 - Obtaining copper

Abstract

Aspects of the present disclosure generally relate to methods and compositions for detecting an association between a RNA binding protein and a RNA. Some aspects of the present disclosure relate to methods of generating an antibody-bead conjugate pool. Some aspects of the present disclosure relate to kits and compositions for performing the methods disclosed herein.

IPC Classes  ?

• C12Q 1/6804 - Nucleic acid analysis using immunogens
• C12Q 1/6806 - Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
• C12Q 1/6834 - Enzymatic or biochemical coupling of nucleic acids to a solid phase
• C12Q 1/6869 - Methods for sequencing

Abstract

A microneedle system is provided including a needle assembly having a microneedle with a longitudinal body with a diameter of about 50 microns to about 200 microns, the microneedle defining a sharpened tip and a proximal end thereof, the microneedle having first and second lumens extending therethrough, each of the first and second lumens having a distal openings located proximal to the sharpened tip and a proximal opening at a proximal end of the microneedle; a base having a distal end and a proximal end, the distal end of the base coupled to the proximal end of the microneedle and defining first and second passages in fluid communication with the first and second lumens; and a pair of tubes coupled to the base, each tube in fluid communication with a respective first and second passage of the base; a syringe pump; and circulation tubing connecting the syringe pump with the pair of tubes in the needle assembly.

IPC Classes  ?

• A61M 37/00 - Other apparatus for introducing media into the bodyPercutany, i.e. introducing medicines into the body by diffusion through the skin
• A61M 5/178 - Syringes

Abstract

The present subject matter relates to devices and techniques for preparing a sample. The disclosed device can include a mixer, a reaction channel, and a micro sprayer. The mixer can be configured to mix at least two components and perform a splitting and recombination (SAR) mixing. The micro sprayer can be configured to generate a droplet of the sample. The mixer and the micro sprayer can be coupled through the reaction channel. The reaction channel can be a microcapillary tubing or a yin-yang reaction channel.

IPC Classes  ?

• B01L 3/00 - Containers or dishes for laboratory use, e.g. laboratory glasswareDroppers
• B01F 33/302 - Micromixers the materials to be mixed flowing in the form of droplets

Abstract

NNNN-phase LC filter comprising one or more capacitors, wherein respective one or more neutral points of the one or more capacitors are electrically connected to a DC negative terminal of a DC source. A control system drives power switching elements of the N-phase power converter stage to convert received power and to output converted power. The control system drives the power switching elements using variable frequency soft switching at a frequency of at least 20 kHz. The power converter may have bidirectional operation to operate in a traction mode to drive a motor or a charging mode to charge a DC source.

IPC Classes  ?

• H02M 7/49 - Combination of the output voltage waveforms of a plurality of converters
• H02M 7/523 - Conversion of DC power input into AC power output without possibility of reversal by static converters using discharge tubes with control electrode or semiconductor devices with control electrode using devices of a thyratron or thyristor type requiring extinguishing means using semiconductor devices only with LC-resonance circuit in the main circuit
• H02M 7/493 - Conversion of DC power input into AC power output without possibility of reversal by static converters using discharge tubes with control electrode or semiconductor devices with control electrode the static converters being arranged for operation in parallel