Abrégé

The subject matter described here relates to anti-PD-1 monoclonal antibodies with increased size that are capable of modulating T-cell activity. In certain embodiments the monoclonal antibody comprises an additional Fc domain or CD22 domain.

Classes IPC  ?

• C07K 16/30 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire provenant de cellules de tumeurs
• A61K 40/33 - AnticorpsActivateurs de lymphocytes T

Abrégé

A power conversion system and method for an electric vehicle includes a bidirectional power system including control circuitry that is electrically connected to interface circuitry and a power converter. The control circuitry is configured to: control, when the control circuitry detects an electrical connection between the interface circuitry and an external power network, a load to output a DC voltage from the load to the power converter; control, when the control circuitry determines that a mode command from a user control includes a traction mode instruction, the load to output the DC voltage from the load to the power converter; and control, when the load outputs the DC voltage, the power converter in a manner that causes the power converter to convert the DC voltage into an electric current.

Classes IPC  ?

• H02M 7/81 - Transformation d'une puissance d'entrée en courant alternatif en une puissance de sortie en courant continuTransformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant alternatif avec possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande agencés pour la marche en parallèle
• H02J 7/02 - Circuits pour la charge ou la dépolarisation des batteries ou pour alimenter des charges par des batteries pour la charge des batteries par réseaux à courant alternatif au moyen de convertisseurs
• H02P 27/08 - Dispositions ou procédés pour la commande de moteurs à courant alternatif caractérisés par le type de tension d'alimentation utilisant une tension d’alimentation à fréquence variable, p. ex. tension d’alimentation d’onduleurs ou de convertisseurs utilisant des convertisseurs de courant continu en courant alternatif ou des onduleurs avec modulation de largeur d'impulsions

Abrégé

The present disclosure provides compositions and vectors comprising a transgene(s) encoding more than one isoform of Crumbs homologue-1 (CRB1) (e.g., CRB1-A and CRB1-B), and compositions thereof, for use in the treatment or prevention of CRB1-related diseases and disorder (e.g., autosomal recessive retinitis pigmentosa (RP) and Leber congenital amaurosis (LCA)).

Classes IPC  ?

• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 27/02 - Agents ophtalmiques
• C07K 14/47 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains provenant de vertébrés provenant de mammifères
• C12N 15/86 - Vecteurs viraux

Abrégé

Compositions for treating hematological conditions such as myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML) are provided. In particular, a population of CD8+ T lymphocytes with cytotoxic activity against leukemia cells is provided, as well as methods of isolating and enriching such cells for therapeutic applications.

Classes IPC  ?

• C12N 5/0783 - Cellules TCellules NKProgéniteurs de cellules T ou NK
• G01N 33/50 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique
• G01N 15/14 - Techniques de recherche optique, p. ex. cytométrie en flux
• C07K 14/705 - RécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire

Abrégé

Disclosed are systems, methods, and other implementations, including a method for configuring a machine learning (ML) system. The method includes determining for a layer, l, of the ML system sets of parameters defining one or more statistical distribution models (e.g., lognormal) used for directing the ML system to an optimized configuration. The layer is connected to one or more other layers through weighted connected, and includes configurable ML elements (e.g., neurons) that can be tuned. The method also includes adjusting one or more of, a) weights of the weighted connections of the layer according to parameters defining a first distribution model, b) adjustable parameters defining the first statistical distribution model, c) ML element parameters, defining operations of at least some of the configurable ML elements, according to parameters defining a second distribution model, and/or d) adjustable parameters defining the second distribution model.

Classes IPC  ?

• G06N 3/08 - Méthodes d'apprentissage

Abrégé

A platform for the detection of vertebrate-infecting viruses in a sample, the platform comprising a plurality of oligonucleotide probes, wherein, for each viral taxon included in the platform, the plurality comprises at least one probe partially or fully complementary to a portion of a predetermined coding sequence of said viral taxon, wherein the predetermined coding sequences of the viral taxa, or fragments thereof, cluster at about 60-100% sequence identity, wherein oligonucleotide probes partially or fully complementary to a portion of a predetermined coding sequence within a single viral taxon cluster at about 70-100% sequence identity, wherein each oligonucleotide probe is about 50-300 nucleotides in length, wherein different oligonucleotide probes of the plurality which bind the same predetermined coding sequence are tiled across said predetermined coding sequence at intervals of about 50-500 nucleotides, and wherein the plurality of oligonucleotide probes of the platform comprises 100,000 to 1,500,000 oligonucleotide probes.

Classes IPC  ?

• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN
• C12Q 1/70 - Procédés de mesure ou de test faisant intervenir des enzymes, des acides nucléiques ou des micro-organismesCompositions à cet effetProcédés pour préparer ces compositions faisant intervenir des virus ou des bactériophages
• C40B 40/06 - Bibliothèques comprenant des nucléotides ou des polynucléotides ou leurs dérivés
• G16B 25/30 - Conception de micromatrices

Abrégé

Biomarker: In our preclinical mouse models of AIHA and in patients with AIHA, we have identified a new T cell population that predicts onset of autoimmune hemolytic anemia. The cell phenotype is: CD4+CD39+CD73-CD25-FoxP3-. These cells secrete IL-17 and/or IFNy upon stimulation, suggesting that they perpetuate autoimmune pathology. Treatment: Failure of tolerance to RBCs leads to modulation of the purinergic signaling pathway. Using our preclinical mouse models of AIHA secondary to checkpoint inhibitors, we have observed that prophylactic/concurrent apyrase treatment mitigates disease onset.

Classes IPC  ?

• G01N 33/68 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique faisant intervenir des protéines, peptides ou amino-acides
• A61K 38/46 - Hydrolases (3)
• A61P 37/06 - Immunosuppresseurs, p. ex. médicaments pour le traitement du rejet de greffe
• C12N 9/16 - Hydrolases (3.) agissant sur les liaisons esters (3.1)
• C12Q 1/6883 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p. ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique

Abrégé

A surgical device, comprising: a handpiece, the handpiece comprising a touch sensor; a shaft extending from the handpiece and having a distal end; a surgical element disposed generally at the distal end of the shaft; and an actuator, the actuator being controllable by the touch sensor, and the actuator modulating movement of the surgical element. A surgical device, comprising: a handpiece; a surgical element; and a control train configured to control a movement of the surgical element in response to a user's touch on a touch sensor of the control train. A method, comprising: in response to a touch on a touch sensor of a surgical device, controlling any one or more of a direction of motion or a degree of motion of a surgical element of the surgical device.

Classes IPC  ?

• A61B 17/285 - Pinces chirurgicales combinées à des instruments coupants
• A61B 17/29 - Pinces pour la chirurgie faiblement invasive
• A61B 17/32 - Instruments chirurgicaux coupants
• A61B 17/00 - Instruments, dispositifs ou procédés chirurgicaux

Abrégé

A cathode active material having a polymer with helical perylene diimide (hPDI) subunits with the side-chains of the helical perylene diimide (hPDI) subunits removed and a method of manufacturing the cathode active material are provided. A rechargeable battery cell with the polymer as a cathode material, a magnesium metal anode, and an ether-based electrolyte.

Classes IPC  ?

• H01M 4/60 - Emploi de substances spécifiées comme matériaux actifs, masses actives, liquides actifs de composés organiques
• H01M 4/02 - Électrodes composées d'un ou comprenant un matériau actif
• H01M 4/38 - Emploi de substances spécifiées comme matériaux actifs, masses actives, liquides actifs d'éléments simples ou d'alliages
• H01M 10/0569 - Matériaux liquides caracterisés par les solvants

Abrégé

Disclosed are methods, systems, devices, and other implementations, including a voltage converter system that includes two or more Active Half Bridge (AHB) converter circuits, each of the two or more AHB converter circuits connected to one or more windings of a transformer, with each AHB converter circuit including one or more switches and one or more energy storage devices. The voltage converter system further includes one or more controllers to control electrical behavior of the two or more AHB converter circuits according to normalized switching functions representing the switching states of the switches of the two or more AHB converter circuits.

Classes IPC  ?

• H02M 3/335 - Transformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant continu avec transformation intermédiaire en courant alternatif par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrodes de commande pour produire le courant alternatif intermédiaire utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande utilisant uniquement des dispositifs à semi-conducteurs
• H02M 1/00 - Détails d'appareils pour transformation

Abrégé

The subject matter described here relates to methods of relocalizing proteins of the immune synapse to modulate T cell activation and the use of such methods to treat a disease in a subject in need thereof. Further described herein are anti-CD45 antibodies, in some embodiments with reduced affinity for CD45, as well as bispecific antibodies capable of modulating T-cell activity, wherein the two arms of the bispecific antibody are against CD45 and PD-1 or against CD43 and PD-1. In certain embodiments the bispecific antibody has reduced affinity for CD45 or CD43.

Classes IPC  ?

• C07K 16/28 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire
• C12N 15/62 - Séquences d'ADN codant pour des protéines de fusion
• C07K 14/715 - RécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire pour des cytokinesRécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire pour des lymphokinesRécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire pour des interférons
• A61P 35/00 - Agents anticancéreux

Abrégé

Compositions and methods for treating or preventing nonalcoholic steatohepatitis (NASH). In one aspect, the disclosed methods relate to targeting a macrophage receptor called cell immunoglobulin and mucin domain containing 4 (TIM4). The compositions and methods disclosed herein can be used as disease modifying therapies to enable treatment of NASH and related disorders earlier in disease progression and improve clinical outcomes.

Classes IPC  ?

• A61K 38/17 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains
• A61P 1/16 - Médicaments pour le traitement des troubles du tractus alimentaire ou de l'appareil digestif des troubles de la vésicule biliaire ou du foie, p. ex. protecteurs hépatiques, cholagogues, cholélitholytiques
• C07K 14/705 - RécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire
• C12N 15/864 - Vecteurs parvoviraux
• G01N 33/50 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique
• A61P 3/06 - Antihyperlipémiants

Abrégé

Provided herein are recombinant miniature swine without expression of endogenous porcine CD47 and SIRPA, but with the expression of human or humanized CD47 and human or humanized SIRPA under the same regulatory elements as the endogenous porcine CD47 and SIRPA. Also provided are cells, tissues, and organs derived from such recombinant miniature swine. Furthermore, provided herein are methods of transplanting a graft from a first donor of such recombinant miniature swine with or without bone marrow from a second donor of such recombinant miniature swine.

Classes IPC  ?

• A01K 67/0278 - Vertébrés knock-in, p. ex. vertébrés humanisés
• C07K 14/47 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains provenant de vertébrés provenant de mammifères
• C07K 14/705 - RécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire
• C12N 15/85 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes eucaryotes pour cellules animales

Abrégé

Disclosed are systems, methods, and other implementations, including a method for battery performance analysis and management that includes measuring voltage response data for a lithium-ion battery in response to a bipolar current pulse signal applied to the lithium-ion battery, and determining, based on the measured voltage response data, using a bipolar pulse (BIP) model resultant battery characterization data representative of linear and nonlinear behavior of the lithium-ion battery. The resultant battery characterization data can include a set of multiple parameters of an equivalent circuit representation of the BIP model.

Classes IPC  ?

• G01R 31/367 - Logiciels à cet effet, p. ex. pour le test des batteries en utilisant une modélisation ou des tables de correspondance
• G01R 31/378 - Dispositions pour le test, la mesure ou la surveillance de l’état électrique d’accumulateurs ou de batteries, p. ex. de la capacité ou de l’état de charge spécialement adaptées à un type de batterie ou d’accumulateur
• G01R 31/3835 - Dispositions pour la surveillance de variables des batteries ou des accumulateurs, p. ex. état de charge ne faisant intervenir que des mesures de tension
• G01R 31/392 - Détermination du vieillissement ou de la dégradation de la batterie, p. ex. état de santé
• H01M 10/0525 - Batteries du type "rocking chair" ou "fauteuil à bascule", p. ex. batteries à insertion ou intercalation de lithium dans les deux électrodesBatteries à l'ion lithium
• H01M 10/42 - Procédés ou dispositions pour assurer le fonctionnement ou l'entretien des éléments secondaires ou des demi-éléments secondaires

Abrégé

PARP inhibitor (PARPi) resistance continues to undermine successful treatment of BRCA-mutant breast cancers in the clinic. Two immunocompetent, orthotopic models of Brca1- and Bard1-mutant breast cancer were generated to explore PARPi resistance mechanisms in vivo. In contrast to the expected DNA-repair-related resistance mechanisms, the models identified activation of FLT1 (VEGFR1) as the basis for PARPi resistance. PARPi-resistant breast tumors with increased expression of FLT1 have increased expression of the FLT1 ligand PIGF in the tumor microenvironment, which activates FLT1 and its downstream effector AKT. Genetic inhibition of Flt1 inhibits AKT activation and causes dramatic tumor regression of PARPi-resistant tumors, while axitinib, a pan-VEGFR antagonist, resensitizes PARPi-resistant breast tumors to PARP inhibition in vivo. It was also discovered that breast cancers expressing high levels of FLT1 before PARPi treatment show faster progression on PARPi. Thus, novel cancer therapeutic compositions and methods related to preventing or reversing PARPi resistance are described herein.

Classes IPC  ?

• A61K 38/46 - Hydrolases (3)
• A61P 35/00 - Agents anticancéreux
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• C12N 9/22 - Ribonucléases
• G01N 33/50 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique
• A61K 31/416 - 1,2-Diazoles condensés avec des systèmes carbocycliques, p. ex. indazole

Abrégé

A modular bioreactor system is provided including a platform having a seat to receive a modular tissue chamber, and one or more platform interfacial members; and a releasable modular tissue chamber including a bottom surface, an open top, and sidewalls defining a well therein, the releasable modular tissue chamber configured to be received by the seat of the platform, the tissue chamber further including an interfacial member configured to releasably connect the modular tissue chamber to the platform, wherein a tissue chamber contains human bone marrow (engineered using iPS cell derived osteoblasts, osteoclasts, endothelial cells, supporting mesenchymal cells, and hematopoietic cells in bone matrix) infused by primary leukemia cells

Classes IPC  ?

• C12M 3/00 - Appareillage pour la culture de tissus, de cellules humaines, animales ou végétales, ou de virus
• C12M 1/12 - Appareillage pour l'enzymologie ou la microbiologie avec des moyens de stérilisation, filtration ou dialyse
• C12M 1/42 - Appareils pour le traitement de micro-organismes ou d'enzymes au moyen d'énergie électrique ou ondulatoire, p. ex. magnétisme, ondes sonores
• C12N 5/09 - Cellules tumorales

Abrégé

Disclosed are systems and methods for motor control using piecewise affine modelling. An electronic controller may determine current values for a motor in a rotational reference frame. Each current value may be associated with a dimension of a set of dimensions of the rotational reference frame. The electronic controller may further determine, based on the current values, a flux linkage value for each of the set of dimensions of the rotational reference frame using a piecewise affine map. The electronic controller may further determine a target flux linkage value for each of the set of dimensions of the rotational reference frame. The electronic controller may then control a power switching network coupled between a power supply and the motor based on the flux linkage values and the target flux linkage values.

Classes IPC  ?

• H02P 21/00 - Dispositions ou procédés pour la commande de machines électriques par commande par vecteur, p. ex. par commande de l’orientation du champ

Abrégé

The present disclosure provides systems, methods, and compositions for prime-editing modification of c.828 splice site mutations in the peripherin-2 gene. Particularly the present disclosure provides systems, methods, and compositions for correcting one or more disease-causing splice site mutations selected from: c.828+3A>T, c.828+1G>A, c.828+2T>C, c.828+1G>T, and combinations thereof.

Classes IPC  ?

• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61K 38/17 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains
• A61P 27/02 - Agents ophtalmiques
• C12N 9/12 - Transférases (2.) transférant des groupes contenant du phosphore, p. ex. kinases (2.7)
• C12N 9/22 - Ribonucléases
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées

Abrégé

Systems and methods of performing temperature swing solvent extraction (TSSE) descaling of produced water and desalination of high-salinity brines, e.g., those having a total dissolved solids (TDS) greater than about 250,000 ppm are capable of producing descaled water products including less than about 5% weight percent TDS. The brine/produced water feedstreams and combined with a solvent having temperature-dependent water solubility at a temperature TL. Water is extracted from the feedstream into the solvent to form a water-in-solvent extract component and a raffinate component, from which a solid phase can be precipitated as more water is portioned in the solvent and basicity increases. Heating of the water-in-solvent extract component reduces the solubility of the water therein, producing a biphasic mixture of dewatered solvent and descaled water that can be separated. Because these systems and methods do not require a phase change of water, these products are achieved with significantly higher energy efficiencies when compared to evaporation-based thermal methods.

Classes IPC  ?

• C02F 1/26 - Traitement de l'eau, des eaux résiduaires ou des eaux d'égout par extraction
• C02F 1/04 - Traitement de l'eau, des eaux résiduaires ou des eaux d'égout par chauffage par distillation ou évaporation
• C02F 1/44 - Traitement de l'eau, des eaux résiduaires ou des eaux d'égout par dialyse, osmose ou osmose inverse
• C02F 1/66 - Traitement de l'eau, des eaux résiduaires ou des eaux d'égout par neutralisationAjustage du pH
• C02F 103/08 - Eau de mer, p. ex. pour le dessalement
• C02F 103/10 - Nature de l'eau, des eaux résiduaires ou des eaux ou boues d'égout à traiter provenant de carrières ou d'activités minières

Abrégé

PAMAM-based nanocarriers with high loading efficiency of chemotherapeutics and high cfNA binding ability enable sustained delivery of chemotherapeutics while inhibiting systemic inflammation caused by the chemotherapy. This is useful for treating both primary and metastatic tumors with attenuated cognitive impairment.

Classes IPC  ?

• A61K 31/337 - Composés hétérocycliques ayant l'oxygène comme seul hétéro-atome d'un cycle, p. ex. fungichromine ayant des cycles à quatre chaînons, p. ex. taxol
• A61K 31/704 - Composés ayant des radicaux saccharide liés à des composés non-saccharide par des liaisons glycosidiques liés à un composé carbocyclique, p. ex. phloridzine liés à un système carbocyclique condensé, p. ex. sennosides, thiocolchicosides, escine, daunorubicine, digitoxine
• A61K 47/54 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p. ex. conjugués polymère-médicament l’ingrédient non actif étant un agent de modification l’agent de modification étant un composé organique
• A61K 47/69 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p. ex. conjugués polymère-médicament le conjugué étant caractérisé par sa forme physique ou sa forme galénique, p. ex. émulsion, particule, complexe d’inclusion, stent ou kit
• A61P 35/04 - Agents anticancéreux spécifiques pour le traitement des métastases

Abrégé

Methods of treating or preventing conditions in a subject are disclosed, the methods including administering to the subject a therapeutically effective amount of ethyl pyruvate, or a derivative or analog thereof, or a pharmaceutical composition thereof. Methods of treating or preventing conditions in a subject including administering to the subject a therapeutically effective amount of ethyl pyruvate, or a derivative or analog thereof, or a pharmaceutical composition thereof, and one or more additional therapeutic agents, are described.

Abrégé

Disclosed are implementations, including a method for medical/clinical monitoring that includes obtaining clinical and physiological measurement data for a patient, and contextual information associated with the patient and representative of location and time at which the clinical and physiological measurement data were obtained, and obtaining clinician behavior data for the clinicians while treating the patient. The method further includes determining intermittently, using an ensemble learning process, based on the measurement data and the contextual information, one of a plurality of medical state prediction models best suited for a current clinical situation associated with the patient. The method additionally includes determining, by the determined medical state prediction model, based on the measurement data and the clinician behavior data, prediction output data representing a medical and/or clinical state trajectory for the patient, and providing notification output data representative of the medical and/or clinical state trajectory for the patient.

Classes IPC  ?

• G16H 50/30 - TIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicalesTIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour le calcul des indices de santéTIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicalesTIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour l’évaluation des risques pour la santé d’une personne
• G16H 50/20 - TIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicalesTIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour le diagnostic assisté par ordinateur, p. ex. basé sur des systèmes experts médicaux
• G16H 50/70 - TIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicalesTIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour extraire des données médicales, p. ex. pour analyser les cas antérieurs d’autres patients

Abrégé

Multi-target ligands, their synthesis, and their use in treating neurodegenerative diseases are provided.

Classes IPC  ?

• A61K 31/395 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines
• A61K 31/167 - Amides, p. ex. acides hydroxamiques ayant des cycles aromatiques, p. ex. colchicine, aténolol, progabide ayant l'atome d'azote d'un groupe carboxamide lié directement au cycle aromatique, p. ex. lidocaïne, paracétamol
• A61K 31/426 - 1,3-Thiazoles
• A61K 31/33 - Composés hétérocycliques

Abrégé

Provided herein are methods of regulating a subject's preference for fat and/or sugar and methods of screening a substance for an ability to activate a nutrient receptor in a subject's gut.

Classes IPC  ?

• A61K 31/5513 - 1,4-Benzodiazépines, p. ex. diazépam
• A61K 31/47 - QuinoléinesIsoquinoléines
• A61K 31/662 - Acides du phosphore ou leurs esters ayant des liaisons P-C, p. ex. foscarnet, trichlorfon
• A61K 38/22 - Hormones
• A61P 3/02 - Nutriments, p. ex. vitamines, minéraux

Abrégé

Compounds for, and methods of, modeling and treating a neurodegenerative disease, including without limitation frontal temporal dementia (FTD), are provided. An effective dose of a pharmaceutical composition is administered to a patient in need thereof, where the pharmaceutical composition targets at least one muscleblind-like protein (MBNL) binding site on exon 10 of microtubule-associated protein tau (MAPT) to block MBNL binding thereto. The at least one MBNL binding site may be 2 binding sites. The pharmaceutical composition may include the nuclease-inactive dCas13d in complex, with one or more guide RNAs, and/or antisense oligonucleotides (ASOs).

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61P 25/28 - Médicaments pour le traitement des troubles du système nerveux des troubles dégénératifs du système nerveux central, p. ex. agents nootropes, activateurs de la cognition, médicaments pour traiter la maladie d'Alzheimer ou d'autres formes de démence
• C12N 9/22 - Ribonucléases
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées

Abrégé

Disrupting convergence of lytic granules produced by cytotoxic lymphocytes allows non-directional degranulation, which improves and broadens killing efficiency of the cytotoxic cells in pathogenic environments such as when used for cancer therapy. Accordingly, methods of inducing multidirectional degranulation by cytotoxic effector cells in a tumor microenvironment, methods of treating a tumor, and related therapeutic composition are described.

Classes IPC  ?

• A61K 39/00 - Préparations médicinales contenant des antigènes ou des anticorps
• C12N 5/0783 - Cellules TCellules NKProgéniteurs de cellules T ou NK
• C12N 9/22 - Ribonucléases
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 15/90 - Introduction stable d'ADN étranger dans le chromosome

Abrégé

The present disclosure provides methods for the generation and purification of proteins and peptides comprising at least one 2-aminoisobutyric acid (Aib) and/or at least one masked form of Aib. The present disclosure further provides masked forms of Aib (e.g., of Formulas I-XVIII) and compositions and cell culture media that include such masked forms of Aib. The present disclosure further provides kits and/or systems for performing the methods described herein.

Classes IPC  ?

• C07D 335/02 - Composés hétérocycliques contenant des cycles à six chaînons comportant un atome de soufre comme unique hétéro-atome du cycle non condensés avec d'autres cycles
• C07D 345/00 - Composés hétérocycliques contenant des cycles comportant des atomes de sélénium ou de tellure comme uniques hétéro-atomes du cycle

Abrégé

Disclosed are systems, methods, computer program products, and other implementations, including a method for signal detection is disclosed that includes obtaining samples of observation data comprising a signal component produced by a source object, and a noise component, and generating based on at least one of the samples of the observation data, processed by a machine learning template derivation system, a filtering template to separate the signal component from the noise component, with the machine learning template derivation system including one or more trainable layers, and with at least one layer of the one or more trainable layers implementing a respective one of one or more iterations of an unrolled optimization process to determine optimized template parameters for the filtering template. The method further includes applying the filtering template to one or more of the samples of the observation data to obtain the signal component of the observation data.

Classes IPC  ?

• G06N 3/084 - Rétropropagation, p. ex. suivant l’algorithme du gradient

Abrégé

The subject matter discloses a metasurface hologram system, including at least a vacuum chamber, where an atomic array is configured to be trapped with various geometries, at least a laser generator, configured to generate one or more incident laser beams, and at least a metasurface hologram, configured to generate trap arrays.

Classes IPC  ?

• G02B 1/00 - Éléments optiques caractérisés par la substance dont ils sont faitsRevêtements optiques pour éléments optiques
• G21K 1/00 - Dispositions pour manipuler des particules ou des rayonnements ionisants, p. ex. pour focaliser ou pour modérer

Abrégé

A 3D printed structure is provided. The structure includes a composition formed from a mixture including an earth component, e.g., naturally occurring soil, subsoil, topsoil, clay, a clay-rich soil, sand, silt, an engineered soil formed of sand and clay, etc.; at least one fiber component, e.g., a bast or leaf fiber, including straw, wheat straw, rice straw, rice husk, reed, hay, hemp, kenaf, banana, sisal, fique, flax, jute, etc.; fluid component, e.g., water, oil, acid, etc.; and at least one additive component, e.g., a bio-based additive such as cellulose, a polypeptide such as gelatin, a polysaccharide such as alginate, guar gum, locust bean gum, chitosan, and xanthan gum, and lime, etc. The mixture includes a weight ratio of about 2-50 parts earth; about 5-50 parts fiber; about 25-80 parts fluid; and about 0-10 parts additive. The mixture can be 3D printed into prefabricated building elements, e.g., block-like geometries, monolithic walls, panels, etc.

Classes IPC  ?

• E04C 2/04 - Éléments de construction de relativement faible épaisseur pour la construction de parties de bâtiments, p. ex. matériaux en feuilles, dalles ou panneaux caractérisés par des matériaux spécifiés en béton ou autre matériau analogue à la pierre en ciment d'amiante
• B28B 1/00 - Fabrication d'objets façonnés à partir du matériau
• B33Y 10/00 - Procédés de fabrication additive
• B33Y 70/10 - Composites de différents types de matériaux, p. ex. mélanges de céramiques et de polymères ou mélanges de métaux et de biomatériaux
• B33Y 80/00 - Produits obtenus par fabrication additive

Abrégé

A method of modifying a nucleotide in a kinase gene on a double-stranded DNA molecule in a mammalian cell, the method comprising introducing to the cell a composition comprising a guide RNA molecule comprising a spacer sequence portion and a fusion protein comprising a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) nuclease and a base editing enzyme.

Classes IPC  ?

• C12N 15/90 - Introduction stable d'ADN étranger dans le chromosome
• C12N 9/22 - Ribonucléases
• C12N 9/78 - Hydrolases (3.) agissant sur les liaisons carbone-azote autres que les liaisons peptidiques (3.5)
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12Q 1/6876 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p. ex. amorces ou sondes

Abrégé

Mechanisms, including systems, methods, and media for establishing authenticity of image content are provided, the methods including: capturing an image using a camera; digitally signing the image using the camera to create a digital signature; and storing a first copy of the image in remote storage with the digital signature. In some embodiments, the image and the digital signature are stored in a blockchain. In some embodiments, the methods further comprise: retrieving a second copy of the image; and determining whether the second copy of the image is authentic based on the digital signature. In some embodiments, the methods further comprise generating an indicator that indicates to a person whether the second copy of the image is authentic. In some embodiments, the methods further comprise storing an indicator of edits made in the edited copy in the blockchain.

Classes IPC  ?

• H04L 9/32 - Dispositions pour les communications secrètes ou protégéesProtocoles réseaux de sécurité comprenant des moyens pour vérifier l'identité ou l'autorisation d'un utilisateur du système
• H04L 9/00 - Dispositions pour les communications secrètes ou protégéesProtocoles réseaux de sécurité

Abrégé

Transmembrane proteases are necessary for HPIV3 fusion protein cleavage in the human lung. HPIV3 fusion protein cleavage in the human lung is not furin dependent as previously thought, but instead is facilitated by transmembrane proteases, typically targeting TMPRSS2 expression. Serine protease inhibitors may be used in this manner to treat HPIV in a patient. Particular serine protease inhibitors shown to be effective include nafamostat, camostat, aprotinin, and leupeptin. Method of treating HPIV use serine protease inhibitors as treating agents.

Classes IPC  ?

• A61K 38/17 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains
• A61K 31/132 - Amines, p. ex. amantadine ayant plusieurs groupes amino, p. ex. spermidine, putrescine
• A61K 31/245 - Esters, p. ex. nitroglycérine, sélénocyanates d'acides carboxyliques ayant un noyau aromatique lié au groupe carboxyle ayant un groupe amino ou nitro du type acide aminobenzoïque, p. ex. procaïne, novocaïne
• A61P 31/16 - Antiviraux pour le traitement des virus ARN de la grippe ou des rhinovirus

Abrégé

The present disclosure provides methods of treating and preventing trigeminal nerve pain with modulators of oxidative stress (e.g., NRF2 transcription network activators and/or inhibitors of transient receptor potential ankyrin 1 (TRPA1)) and compositions thereof.

Classes IPC  ?

• A61K 33/24 - Métaux lourdsLeurs composés
• A61K 31/26 - Esters d'acide cyanique ou isocyaniqueEsters d'acide thiocyanique ou isothiocyanique
• A61K 31/522 - Purines, p. ex. adénine ayant des groupes oxo liés directement à l'hétérocycle, p. ex. hypoxanthine, guanine, acyclovir
• A61K 31/551 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à sept chaînons, p. ex. azélastine, pentylènetétrazole ayant deux atomes d'azote comme hétéro-atomes d'un cycle, p. ex. clozapine, dilazèpe
• A61K 31/5685 - Composés contenant des systèmes cycliques du cyclopenta[a]hydrophénanthrèneLeurs dérivés, p. ex. stéroïdes non substitués en position 17 bêta par un atome de carbone, p. ex. œstrane, œstradiol substitués en positions 10 et 13 par une chaîne ayant au moins un atome de carbone, p. ex. androstane, testostérone ayant un groupe oxo en position 17, p. ex. androstérone
• A61P 25/04 - Analgésiques centraux, p. ex. opioïdes

Abrégé

This disclosure is related to a method of sequencing a single-stranded DNA using deoxynucleotide polyphosphate analogues and translocation of tags from incorporated deoxynucleotide polyphosphate analogues through a nanopore.

Classes IPC  ?

• C12Q 1/6869 - Méthodes de séquençage
• C07H 19/10 - Radicaux pyrimidine avec le radical saccharide estérifié par des acides phosphoriques ou polyphosphoriques
• C07H 21/00 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques
• G01N 33/487 - Analyse physique de matériau biologique de matériau biologique liquide

Abrégé

Media for making esophageal organoids, methods of making an esophageal organoid using that media, and esophageal organoids produced by those methods

Classes IPC  ?

• C12N 5/071 - Cellules ou tissus de vertébrés, p. ex. cellules humaines ou tissus humains
• C12N 5/09 - Cellules tumorales

Abrégé

Disclosed herein are vectors, synthetic antibodies, and methods of producing and using the same, comprising at least one polynucleotide sequence encoding an antibody or fragment thereof, wherein a variable heavy chain domain of the antibody or fragment thereof comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7, and a variable light chain domain of the antibody or fragment thereof comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.

Classes IPC  ?

• C07K 16/10 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant de virus de virus à ARN
• A61K 39/42 - AnticorpsImmunoglobulinesImmunsérum, p. ex. sérum antilymphocitaire viraux

Abrégé

The present disclosure relates to compositions for increasing acetylated alpha-tubulin levels in peripheral neuronal cells. The present disclosure also relates to the use of tubulin deacetylase inhibitors, or activators of tubulin acetylation for increasing acetylated tubulin levels in the cells. The present disclosure also relates to methods for assessing risk of developing peripheral neuropathy by assessing the levels of acetylated alpha-tubulin. The present disclosure further relates to methods for treating a subject suffering from a peripheral neuropathy using the compositions described herein.

Classes IPC  ?

• A61K 31/437 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle condensés en ortho ou en péri avec des systèmes hétérocycliques le système hétérocyclique contenant un cycle à cinq chaînons ayant l'azote comme hétéro-atome du cycle, p. ex. indolizine, bêta-carboline
• A61P 25/02 - Médicaments pour le traitement des troubles du système nerveux des neuropathies périphériques
• C12Q 1/6883 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p. ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique
• G01N 33/68 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique faisant intervenir des protéines, peptides ou amino-acides
• A61K 31/422 - Oxazoles non condensés et contenant d'autres hétérocycles

Abrégé

The present, disclosure relates to anti-SAA antibodies or fragments thereof, such as antibodies against human SAA1 or fragments thereof, that may be used in various therapeutic, prophylactic and diagnostic methods. The present antibodies or fragments thereof may be used to treat hematologic disorders such as acute myeloid leukemia, acute lymphoid leukemia, and myelodysplastic syndrome.

Classes IPC  ?

• C07K 16/28 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire
• C07K 16/00 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux
• A61K 39/395 - AnticorpsImmunoglobulinesImmunsérum, p. ex. sérum antilymphocitaire

Abrégé

The subject matter described herein relates to a method of treating cancer in a subject in need thereof using a bispecific molecule recognizing two antigen markers of different tissue lineages on the surface of The First Cell.

Classes IPC  ?

• C07K 16/30 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire provenant de cellules de tumeurs
• A61K 47/68 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p. ex. conjugués polymère-médicament l’ingrédient non actif étant un agent de modification l’agent de modification étant un anticorps, une immunoglobuline ou son fragment, p. ex. un fragment Fc
• C07K 16/28 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire
• G01N 33/574 - Tests immunologiquesTests faisant intervenir la formation de liaisons biospécifiquesMatériaux à cet effet pour le cancer

Abrégé

Treatments and methods for inhibiting late Na current use fibroblast growth factor homologous factor (FHF), an endogenous channel modulator, to inhibit late Na current with high potency. A minimal effector domain is engineered within FHF (the “FHF-inhibiting-X-region” (FixR)) as a peptide inhibitor of late Na current that may be delivered intracellularly, for example as a cell-penetrating peptide, or via viral or plasmid delivery. As a non-limiting example, human adenovirus type 5 may be genetically modified with the sequence 5′-ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAG TCCAACAGCGACCGAGTGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGAC GGGCGCTCC-3′ (SEQ ID NO: 1). As pathophysiological impact of late Na current extends beyond cardiac myocytes to other physiological settings, including neurons of the central and peripheral nervous system and skeletal muscle, these treatments and methods provide potential therapeutic avenues for a range of human ailments, including cardiac conditions, neurological/neuropsychiatric disorders, and skeletal muscle conditions. Neurological/neuropsychiatric disorders include, for example, epilepsy and autism spectrum disorders, pain-related diseases, and myotonia.

Classes IPC  ?

• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61K 38/18 - Facteurs de croissanceRégulateurs de croissance
• A61P 9/06 - Antiarythmiques
• C12N 15/86 - Vecteurs viraux

Abrégé

2223222222 desorption decreases the energy costs associated with direct air capture of carbon dioxide.

Classes IPC  ?

• B01D 53/62 - Oxydes de carbone

Abrégé

The method of treating obesity and targeting adipose tissue in a patient may use injection of a polycationic polymer, such as polyamidoamine (PAMAM) generation 3 (P-G3) or a PCL-g-PAMAM Denpol, that when delivered intraperitoneally, selectively targets visceral adiposity due to its high charge density. P-G3 treatment of obese mice inhibits visceral adiposity, increases energy expenditure, prevents obesity, and alleviates associated metabolic dysfunctions. The extracellular matrix of adipose tissue is enriched with glycosaminoglycans, the known biomacromolecules with the strongest negative charge. P-G3 uncouples adipocyte lipid synthesis and storage from adipocyte development, creating adipocytes with normal functions but that are deficient in hypertrophic growth. The visceral fat distribution of P-G3 is further enhanced by modifying P-G3 with cholesterol to form lipophilic nanoparticles, effective in treating obesity. This strategy provides a method to target visceral adiposity, and cationic nanomaterials useful for treating metabolic diseases or for delivery of additional treating agents.

Classes IPC  ?

• A61K 31/785 - Polymères contenant de l'azote
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p. ex. composés antiphlogistiques et pour le cœur
• A61K 47/28 - Stéroïdes, p. ex. cholestérol, acides biliaires ou acide glycyrrhétinique
• A61P 3/04 - AnorexigènesMédicaments de l'obésité

Abrégé

Examples of syringe assemblies and sets of components are disclosed for transferring a fluid sample for testing. In some examples, the syringe assembly comprises a housing, a barrel, a plunger reciprocally moveable in the barrel, a narrow tube connected to the barrel, and a metering actuator configured to control movement of the plunger at least in a proximal direction relative to the barrel. The metering actuator is configured to draw a precise microvolume of the fluid sample into a fluid chamber within the syringe assembly. In some examples, while the fluid chamber holds the fluid sample, the distal tip of the narrow tube remains covered, for example inside the housing or a reaction container. The syringe assembly is configured to expel the fluid sample from the fluid chamber into the reaction container.

Classes IPC  ?

• B01L 3/02 - BurettesPipettes

Abrégé

Processes, compositions, and apparatus are disclosed. A first process includes providing a cyclopropenimine (CPI). A second process includes providing 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU). The first and second processes include reacting the CPI and DBU, respectively, with carbon dioxide (CO2) in the presence of a nucleophilic species (NuH) and releasing CO2 from products of the reactions by heating to a temperature below about 120° C. A process of direct air capture includes obtaining atmospheric CO2, reacting the CO2 with an organic base having an imine moiety to form a NuCO2− salt, and heating the NuCO2− salt to a temperature below about 120° C. A composition for low-temperature CO2 release includes a tris(amino)cyclopropenium (TAC+) ion and NuCO2−. An apparatus includes a component configured to provide a composition, including a CPI, for capturing CO2 and a component configured to release the CO2 by heating a to a temperature below 120° C.

Classes IPC  ?

• B01J 20/26 - Composés macromoléculaires synthétiques
• B01D 53/04 - Séparation de gaz ou de vapeursRécupération de vapeurs de solvants volatils dans les gazÉpuration chimique ou biologique des gaz résiduaires, p. ex. gaz d'échappement des moteurs à combustion, fumées, vapeurs, gaz de combustion ou aérosols par adsorption, p. ex. chromatographie préparatoire en phase gazeuse avec adsorbants fixes
• B01J 20/28 - Compositions absorbantes ou adsorbantes solides ou compositions facilitant la filtrationAbsorbants ou adsorbants pour la chromatographieProcédés pour leur préparation, régénération ou réactivation caractérisées par leur forme ou leurs propriétés physiques
• B01J 20/32 - Imprégnation ou revêtement

Abrégé

22; and an amount of acid disposed in the container.

Classes IPC  ?

• H01M 10/52 - Enlèvement des gaz situés à l'intérieur de l'élément secondaire, p. ex. par absorption
• C25B 1/30 - Peroxydes
• C22B 1/00 - Traitement préliminaire de minerais ou de débris ou déchets métalliques
• C22B 3/00 - Extraction de composés métalliques par voie humide à partir de minerais ou de concentrés
• C22B 26/12 - Obtention du lithium

Abrégé

Provided herein are compositions, methods, and systems for DNA modification. In particular, provided herein are compositions, and systems comprising TnpB-like nuclease-dead repressors (dTnpB/TldRs), dCas12f or dCas12f-like proteins, and/or a TnpB-transposase fusion proteins and methods using thereof.

Classes IPC  ?

• C12N 9/22 - Ribonucléases
• C12N 15/74 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes procaryotes autres que E. coli, p. ex. Lactobacillus, Micromonospora

Abrégé

Disclosed are methods of epigenetic mapping with low input capabilities that enable applications to human tissues. The method can also be incorporated with automated/semi-automated capabilities to enable the use epigenetic mapping in prospective clinical trials. The methods comprise shearing the isolated chromatin using focused ultrasonication technology, preferably at least twice, prior to immunoprecipitation of the sheared chromatin and isolation for subsequent DNA analysis.

Classes IPC  ?

• C12Q 1/6806 - Préparation d’acides nucléiques pour analyse, p. ex. pour test de réaction en chaîne par polymérase [PCR]

Abrégé

Compositions and methods for treating or preventing nonalcoholic steatohepatitis (NASH) fibrosis, also known as MASH. In one aspect, the disclosed methods relate to targeting a MBOAT7 risk variant, rs641738, in order to increase MBOAT7 expression and down-stream signaling or to silence TAZ. The compositions and methods disclosed herein can be used as disease modifying therapies to enable treatment of NASH fibrosis/MASH and related disorders earlier in disease progression and improve clinical outcomes.

Classes IPC  ?

• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61K 38/45 - Transférases (2)
• C12N 15/86 - Vecteurs viraux

Abrégé

Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Also disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using polynucleotides, polypeptides and/or agents which increase efficiency of the “fork reversion and repair” pathway and/or decrease detrimental outcomes such as fork collapse, translesion synthesis and/or gap formation. Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Also disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using polynucleotides, polypeptides and/or agents which increase efficiency of the “fork reversion and repair” pathway and/or decrease detrimental outcomes such as fork collapse, translesion synthesis and/or gap formation. Lastly disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using one or more polynucleotides or polypeptides including but not limited to CHEK1, WEE1, ETAA1, ATRX, BLM, BRCA2, CHD4, DNA2 (DNA2L), EXO1, FANCC, FANCG, FBH1 (FBX018), HLTF (SMARCA3), MCM9, MSH6, POLD3, POLK, RAD51, RAD52, RAD54L, RB1, RECQL, REV3L, RIF1, RNF8, SETD1A, SHPRH, SMARCAL1, TDRD3, TOPBP1, TP53BP1, WRNIP1, XRCC2, WRN, BRCAI, ZRANB3, CDC6, CDT1, POLH, POLI, FANCD2, INO80, FANCB, ASH2L, FAM35A, XRCC3, BRIP1, and RNF168.

Classes IPC  ?

• C12N 5/073 - Cellules ou tissus embryonnairesCellules fœtales ou tissus fœtaux
• C12N 9/22 - Ribonucléases
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 15/90 - Introduction stable d'ADN étranger dans le chromosome

Abrégé

Compounds and compositions comprising compounds that modulate histone acyl transferase (HAT). Methods for treating neurodegenerative disorders, conditions associated with accumulated amyloid-beta peptide deposits, Tau protein levels, and/or accumulations of alpha-synuclein as well as cancer by administering a compound that modulates HAT to a subject.

Classes IPC  ?

• A61K 31/395 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines
• A61K 31/397 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à quatre chaînons, p. ex. azétidine
• A61K 31/454 - Pipéridines non condensées, p. ex. pipérocaïne contenant d'autres systèmes hétérocycliques contenant un cycle à cinq chaînons avec l'azote comme hétéro-atome du cycle, p. ex. pimozide, dompéridone
• A61K 31/435 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle
• A61K 31/33 - Composés hétérocycliques

Abrégé

Provided are devices that have a distal portion configured to be implanted in a brain of a subject. The distal portion includes one or more emitters configured to emit light in the visible spectrum. The device includes a proximal portion configured to be external to the brain of the subject while the distal portion is implanted, wherein the proximal portion includes at least one waveguide in optical communication with the one or more emitters. The at least one waveguide defines a cross-sectional width less than 500 nm. The at least one waveguide is optionally coupled to a heating element that is optionally configured to adjust a phase of light within the at least one waveguide.

Classes IPC  ?

• G02F 1/01 - Dispositifs ou dispositions pour la commande de l'intensité, de la couleur, de la phase, de la polarisation ou de la direction de la lumière arrivant d'une source lumineuse indépendante, p. ex. commutation, ouverture de porte ou modulationOptique non linéaire pour la commande de l'intensité, de la phase, de la polarisation ou de la couleur
• A61N 5/06 - Thérapie par radiations utilisant un rayonnement lumineux

Abrégé

The present inhibitory polypeptides/peptides are derived from an envelope (E) protein of a coronavirus (e.g., human coronaviruses such as SARS-CoV-2). The polypeptides/peptides against coronaviruses can be used to treat or prevent infection by a coronavirus in a subject.

Classes IPC  ?

• C07K 14/005 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant de virus
• A61K 38/00 - Préparations médicinales contenant des peptides
• A61P 31/14 - Antiviraux pour le traitement des virus ARN

Abrégé

A cathode active material having a polymer with helical perylene diimide (hPDI) subunits with the side-chains of the helical perylene diimide (hPDI) subunits removed and a method of manufacturing the cathode active material are provided. A rechargeable battery cell with the polymer as a cathode material, a magnesium metal anode, and an ether-based electrolyte.

Classes IPC  ?

• H01M 4/60 - Emploi de substances spécifiées comme matériaux actifs, masses actives, liquides actifs de composés organiques
• C08G 61/12 - Composés macromoléculaires contenant d'autres atomes que le carbone dans la chaîne principale de la macromolécule

Abrégé

Provided herein are methods of xenotransplantation, for example, porcine to human transplantation. Also provided herein are extracellular vesicles (“EVs”, e.g., exosomes) and compositions comprising the same. e.g. EVs expressing human CD47. Further provided herein are methods of making EVs and use thereof for xenotransplantation. In some aspects, the methods of xenotransplantation comprise steps of expressing human CD47 on xenografts.

Classes IPC  ?

• A61K 35/12 - Substances provenant de mammifèresCompositions comprenant des tissus ou des cellules non spécifiésCompositions comprenant des cellules souches non embryonnairesCellules génétiquement modifiées
• C12N 5/071 - Cellules ou tissus de vertébrés, p. ex. cellules humaines ou tissus humains

Abrégé

The present disclosure provides, inter alia, methods for treating neurodegenerative disease including Alzheimer's disease. Methods for restoring retromer complex function in a subject, methods for determining the progression of a neurodegenerative disease in a subject, and in vivo methods for identifying a DNA-binding profile of a dimeric transcription factor complex such as the retromer complex are also provided. Further provided are methods for restoring amyloid precursor protein (APP) homeostasis in a subject in need thereof, methods for restoring tau metabolism in a subject in need thereof, compositions and methods for preventing CREB3L2-ATF4 heterodimerization in a subject using such compositions, and methods for rescuing AP42-induced neuronal cell death in a subject using such compositions.

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• C12Q 1/6874 - Méthodes de séquençage faisant intervenir des réseaux d’acides nucléiques, p. ex. séquençage par hybridation [SBH]
• C12Q 1/6883 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p. ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique
• G01N 33/68 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique faisant intervenir des protéines, peptides ou amino-acides

Abrégé

Described herein is a method for diagnosing cancer in a subject, the method comprising determining methylation status at a plurality of CpG sites within a region of a RAD9 gene in DNA present in a urine sample from the subject, wherein an amount of methylation of the plurality of CpG sites that exceeds a threshold indicates that the subject has cancer. Also described are methods of treatment, methods of assessing a methylation status of DNA present in a urine sample obtained from a human subject, methods of detecting methylation or unmethylation of a RAD9 DNA molecule of a human subject, kits, nucleic acid primers, and compositions.

Classes IPC  ?

• C12Q 1/6886 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p. ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique pour le cancer

Abrégé

The invention relates to methods and pharmaceutical compositions effective for treating, inhibiting, preventing, slowing, or delaying the onset of a neurodegenerative disease in mammals (e.g., humans) via the co-administration of an effective amount of a compound selected from the group consisting of Formula (I), Formula (II), Formula (III) or Formula (IV) or pharmaceutically acceptable salts thereof and a phosphodiesterase inhibitor (e.g., a PDE 5 inhibitor). In certain embodiments, the mammal is a healthy human, or a human experiencing cognitive dysfunction with or without hypertension.

Classes IPC  ?

• A61K 31/407 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à cinq chaînons avec un azote comme seul hétéro-atome d'un cycle, p. ex. sulpiride, succinimide, tolmétine, buflomédil condensés avec des systèmes hétérocycliques, p. ex. kétorolac, physostigmine
• A61K 31/47 - QuinoléinesIsoquinoléines
• A61K 31/4985 - Pyrazines ou pipérazines condensées en ortho ou en péri avec des systèmes hétérocycliques
• A61K 31/506 - PyrimidinesPyrimidines hydrogénées, p. ex. triméthoprime non condensées et contenant d'autres hétérocycles
• A61K 31/519 - PyrimidinesPyrimidines hydrogénées, p. ex. triméthoprime condensées en ortho ou en péri avec des hétérocycles
• A61K 31/53 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec trois azote comme seuls hétéro-atomes d'un cycle, p. ex. chlorazanil, mélamine
• A61P 25/16 - Antiparkinsoniens
• A61P 25/28 - Médicaments pour le traitement des troubles du système nerveux des troubles dégénératifs du système nerveux central, p. ex. agents nootropes, activateurs de la cognition, médicaments pour traiter la maladie d'Alzheimer ou d'autres formes de démence

Abrégé

A method of treating or preventing glaucoma in a subject is disclosed wherein the method includes administering to the subject a therapeutically effective amount of a therapeutic agent comprising MFSD2A, a derivative of MFSD2A or a modulator of MFSD2A, or a pharmaceutical composition thereof.

Classes IPC  ?

• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p. ex. composés antiphlogistiques et pour le cœur
• A61K 31/443 - Pyridines non condenséesLeurs dérivés hydrogénés contenant d'autres systèmes hétérocycliques contenant un cycle à cinq chaînons avec l'oxygène comme hétéro-atome du cycle
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 27/06 - Agents antiglaucomateux ou myotiques
• C07K 14/705 - RécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire
• C07K 16/18 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains

Abrégé

The present disclosure relates to methods and systems for improved specificity and/or efficiency of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated transposon (CAST) system. In particular, the present disclosure provides systems and methods for increasing specificity and efficiency of CAST system by: modulating TnsC function and abundance; modulating TnsB function and abundance; and influencing CAST target preference.

Classes IPC  ?

• C12N 9/22 - Ribonucléases
• C12N 15/52 - Gènes codant pour des enzymes ou des proenzymes
• C12N 15/63 - Introduction de matériel génétique étranger utilisant des vecteursVecteurs Utilisation d'hôtes pour ceux-ciRégulation de l'expression
• C12N 5/10 - Cellules modifiées par l'introduction de matériel génétique étranger, p. ex. cellules transformées par des virus
• C07K 14/195 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant de bactéries
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens

Abrégé

Multiple fluorophores within a sample can be imaged by merging a plurality of beams from different wavelength light sources of excitation light into a single path, directing the excitation light into the sample, and detecting light emitted by the fluorophores within the sample on two different arrays of pixels (e.g., two regions within a single camera sensor chip). The light sources are activated during respective timeslots, and captured image data is processed. For at least one of the timeslots, the processing of the image data comprises using the image data captured using the first array of pixels to detect a presence of a given fluorophore, and using the image data captured using the second array of pixels to detect a presence of a different fluorophore. This arrangement enables a system that includes only N light sources to image more than N fluorophores.

Classes IPC  ?

• G01N 21/64 - FluorescencePhosphorescence

Abrégé

The hybrid nanoporous membranes are assembled from inorganic 3D nanospiky particles and polymers, and can be used to filter, capture, and manipulate environmental or biological substances. These materials provide efficient, continuous filtration of ultrasmall biological substances with sizes less than 100 nm while still maintaining air or fluid flow through the materials.

Classes IPC  ?

• B01D 39/20 - Autres substances filtrantes autoportantes en substance inorganique, p. ex. papier d'amiante ou substance filtrante métallique faite de fils métalliques non-tissés
• A41D 13/11 - Masques de protection du visage, p. ex. pour utilisation chirurgicale ou pour utilisation en atmosphère polluée
• B01D 39/16 - Autres substances filtrantes autoportantes en substance organique, p. ex. fibres synthétiques

Abrégé

An exemplary system, method, and computer-accessible medium for generating diagnostic data associated with a likelihood a patient(s) developing a mental disease(s) can be provided, which can include, for example, providing a visual patterns to the patient(s), receiving electroencephalogram (EEG) information from the patient(s) that can be based on the visual pattern(s); and generating the diagnostic data based on the EEG information.

Classes IPC  ?

• A61B 5/378 - Stimuli visuels
• A61B 5/00 - Mesure servant à établir un diagnostic Identification des individus
• A61B 5/374 - Détection de la répartition de fréquence dans les signaux, p. ex. détection des ondes delta, thêta, alpha, bêta ou gamma

Abrégé

The present invention describes a fusion protein or peptide conjugate comprising the functional domain of a cardiac-specific short chain amino acid with low affinity for the CaVβ-subunit conjugated. The fusion protein or peptide conjugate upregulates the function of L-type calcium channels in a cell-type dependent manner. In some aspects, the fusion protein is a chimeric genetically encoded enhancer of calcium channels (GeeC) comprising the functional domain of a cardiac-specific short chain amino acid with low affinity for the CaVβ-subunit conjugated to a functionally inert nanobody with high affinity to the CaVβ-subunit. In some aspects, GeeC enables targeted upregulation of CaV1.2/1.3 channels in diverse physiological settings thereby opening new avenues to development of future therapeutics. Methods for creating and administering the GeeC to human and non-human animals for the purposes of experimenting and treating cardiac, neurological, and psychiatric pathologies are also described.

Classes IPC  ?

• C07K 14/705 - RécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire
• C07K 16/28 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire
• C07K 19/00 - Peptides hybrides
• C12N 15/62 - Séquences d'ADN codant pour des protéines de fusion
• C12N 15/86 - Vecteurs viraux
• A61P 9/00 - Médicaments pour le traitement des troubles du système cardiovasculaire

Abrégé

A method for injecting a therapeutic into the inner ear of a subject comprising providing a microneedle having a sharpened distal tip and a shaft with a maximum outer diameter of about 75 microns to about 150 microns, the microneedle defining an inner lumen with a diameter about 15 microns to about 50 microns; the inner lumen having a curvature near the needle tip such that the lumen opened at the side of the needle proximal the needle tip; the microneedle mounted on a blunt metallic syringe needle; the blunt metallic syringe needle attached to a syringe secured to a micropump; advancing the microneedle into the middle ear space and the perforating the round window membrane (RWM) with the needle tip; extending the needle such that the inner lumen is disposed in the inner ear space; injecting a volume of therapeutic into the inner ear space; and retracting of the microneedle from the RWM.

Classes IPC  ?

• A61M 37/00 - Autres appareils pour introduire des agents dans le corpsPercutanisation, c.-à-d. introduction de médicaments dans le corps par diffusion à travers la peau

Abrégé

New therapies for macular degeneration and TTR amyloidosis are provided based on a co-drug that represents a conjugate of two distinct chemical entities as well as co- administration and sequential administration of the two chemical entities. The first component ("selective TTR ligand") is a chemical entity that engages TTR (transthyretin) of the RBP4 (retinol binding protein 4) -TTR complex, which is involved in delivery of retinol to the retina. This component reduces traffic of retinol from circulation to the retina and provides stabilization of TTR tetramers. The second component ("C20-D3-visual- chromophore-producing compound") is a C20-D3-modified retinoid or carotenoid that upon metabolism in a mammal can eventually produce a C20-D3 visual chromophore that represents C20-D3-9-cis-retinaldehyde or C20-D3-11-cis-retinaldehyde in the retina. Deuteration at the C20 position reduces the formation of lipofuscin bisretinoid while other functions (such as providing a precursor for in vivo synthesis of the visual chromophore, 11-cis-retinaldehyde) are not reduced.

Classes IPC  ?

• C07D 401/04 - Composés hétérocycliques contenant plusieurs hétérocycles comportant des atomes d'azote comme uniques hétéro-atomes du cycle, au moins un cycle étant un cycle à six chaînons avec un unique atome d'azote contenant deux hétérocycles liés par une liaison directe de chaînon cyclique à chaînon cyclique
• C07D 401/14 - Composés hétérocycliques contenant plusieurs hétérocycles comportant des atomes d'azote comme uniques hétéro-atomes du cycle, au moins un cycle étant un cycle à six chaînons avec un unique atome d'azote contenant au moins trois hétérocycles
• C07D 403/04 - Composés hétérocycliques contenant plusieurs hétérocycles, comportant des atomes d'azote comme uniques hétéro-atomes du cycle, non prévus par le groupe contenant deux hétérocycles liés par une liaison directe de chaînon cyclique à chaînon cyclique
• A61K 31/07 - Composés du rétinol, p. ex. vitamine A
• A61K 31/203 - Acides rétinoïques
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p. ex. composés antiphlogistiques et pour le cœur
• A61K 31/506 - PyrimidinesPyrimidines hydrogénées, p. ex. triméthoprime non condensées et contenant d'autres hétérocycles
• A61P 27/02 - Agents ophtalmiques

Abrégé

ciscisin vivoin vivo synthesis of the visual chromophore, 11-cis-retinaldehyde) are not reduced.

Classes IPC  ?

• A61K 31/395 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines
• A61K 31/445 - Pipéridines non condensées, p. ex. pipérocaïne
• A61K 31/41 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à cinq chaînons avec plusieurs hétéro-atomes cycliques, l'un au moins étant l'azote, p. ex. tétrazole
• A61K 31/33 - Composés hétérocycliques

Abrégé

New therapies for macular degeneration and TTR amyloidosis are provided based on a co-drug that represents a conjugate of two distinct chemical entities as well as co- administration and sequential administration of the two chemical entities. The first component ("bispecific RBP4 /TTR ligand") is a chemical entity that engages TTR ( transthyretin) and RBP4 ( retinol binding protein 4 ) of the RBP4 -TTR complex, which is involved in delivery of retinol to the retina. This component reduces traffic of retinol from circulation to the retina and provides stabilization of TTR tetramers. The second component ("C20-D3-visual-chromophore-producing compound" ) is a C20 -D3 -modified retinoid or carotenoid that upon metabolism in a mammal can eventually produce a C20-D3 visual chromophore that represents C20 -D3- 9-cis-retinaldehyde or C20-D3-11-cis-retinaldehyde in the retina. Deuteration at the C20 position reduces the formation of lipofuscin bisretinoid while other functions ( such as providing a precursor for in vivo synthesis of the visual chromophore, 11-cis-retinaldehyde ) are not reduced.

Classes IPC  ?

• C07D 401/04 - Composés hétérocycliques contenant plusieurs hétérocycles comportant des atomes d'azote comme uniques hétéro-atomes du cycle, au moins un cycle étant un cycle à six chaînons avec un unique atome d'azote contenant deux hétérocycles liés par une liaison directe de chaînon cyclique à chaînon cyclique
• C07D 401/14 - Composés hétérocycliques contenant plusieurs hétérocycles comportant des atomes d'azote comme uniques hétéro-atomes du cycle, au moins un cycle étant un cycle à six chaînons avec un unique atome d'azote contenant au moins trois hétérocycles
• C07D 403/04 - Composés hétérocycliques contenant plusieurs hétérocycles, comportant des atomes d'azote comme uniques hétéro-atomes du cycle, non prévus par le groupe contenant deux hétérocycles liés par une liaison directe de chaînon cyclique à chaînon cyclique
• A61K 31/07 - Composés du rétinol, p. ex. vitamine A
• A61K 31/203 - Acides rétinoïques
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p. ex. composés antiphlogistiques et pour le cœur
• A61K 31/506 - PyrimidinesPyrimidines hydrogénées, p. ex. triméthoprime non condensées et contenant d'autres hétérocycles
• A61P 27/02 - Agents ophtalmiques

Abrégé

Provided herein are engineered insulin polypeptide that exhibit disrupted cross-β fibrillation and pharmaceutical compositions comprising the polypeptides. The disclosure also provides are methods for making the insulin polypeptide. Also included are methods of using the pharmaceutical compositions to treat diabetes and hyperglycemia.

Classes IPC  ?

• C07K 14/62 - Insulines
• A61K 38/28 - Insulines
• A61P 3/10 - Médicaments pour le traitement des troubles du métabolisme de l'homéostase du glucose de l'hyperglycémie, p. ex. antidiabétiques

Abrégé

inter aliainter alia, compositions and methods for treating premature aging of muscle stem cells to combat myopathy by targeting Cdkn2a.

Classes IPC  ?

• A61K 31/711 - Acides désoxyribonucléiques naturels, c.-à-d. contenant uniquement des 2'-désoxyriboses liés à l'adénine, la guanine, la cytosine ou la thymine et ayant des liaisons 3'-5' phosphodiester
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p. ex. composés antiphlogistiques et pour le cœur

Abrégé

In one aspect the present invention is directed to mutant NGAL proteins that have the ability to bind to siderophores, such as enterochelin, and to chelate and transport iron, and that are excreted in the urine. Such NGAL mutants, and complexes thereof with siderophores, can be used to clear excess iron from the body, for example in the treatment of iron overload. The NGAL mutants of the invention also have antibacterial activity and can be used in the treatment of bacterial infections, such as those of the urinary tract.

Classes IPC  ?

• C07K 14/47 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains provenant de vertébrés provenant de mammifères
• A61K 38/00 - Préparations médicinales contenant des peptides

Abrégé

An animal positioned on a perforated platform can be stimulated in an automated fashion. Images of the animal's paw are captured using a bottom-view camera positioned below the platform. Based on these images, an upwards-pointing tool is moved until it is directly beneath the paw. The animal is then stimulated automatically by moving the tool upwards to contact the paw, then moving it back down to cease the contact. Images of the animal are captured using at least one side-view camera, and these images can be analyzed to ascertain the animal's response to the stimulus.

Classes IPC  ?

• A01K 29/00 - Autres appareils pour l'élevage
• A01K 1/03 - Logements pour animaux domestiques ou de laboratoire
• A01K 15/02 - Équipement pour l'entraînement ou l'exercice, p. ex. labyrinthes pour animaux

Abrégé

Disclosed are systems and methods for motor control using optimal efficiency reference generation. An electronic controller may determine current values for a motor in a rotational reference frame. Each current value may be associated with a dimension of a set of dimensions of the rotational reference frame. The electronic controller may further determine, based on the current values, a flux linkage value for each of the set of dimensions of the rotational reference frame using an optimization cost function that considers motor speed, copper loss, and core loss. The electronic controller may further determine a target flux linkage value for each of the set of dimensions of the rotational reference frame. The electronic controller may then control a power switching network coupled between a power supply and the motor based on the flux linkage values and the target flux linkage values.

Classes IPC  ?

• H02P 9/10 - Commande s'exerçant sur le circuit d'excitation de la génératrice afin de réduire les effets nuisibles de surcharges ou de phénomènes transitoires, p. ex. application, suppression ou changement brutal de la charge

Abrégé

The present invention relates to methods for regulating prohormone convertase (PC1) and compounds and treatments which increase PC1 levels, for treating Prader-Willi Syndrome (PWS).

Classes IPC  ?

• A61K 31/366 - Lactones ayant des cycles à six chaînons, p. ex. delta-lactones
• A61K 31/277 - NitrilesIsonitriles ayant un cycle, p. ex. vérapamil
• A61K 31/352 - Composés hétérocycliques ayant l'oxygène comme seul hétéro-atome d'un cycle, p. ex. fungichromine ayant des cycles à six chaînons avec un oxygène comme seul hétéro-atome d'un cycle condensés avec des carbocycles, p. ex. cannabinols, méthanthéline
• A61K 31/4015 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à cinq chaînons avec un azote comme seul hétéro-atome d'un cycle, p. ex. sulpiride, succinimide, tolmétine, buflomédil ayant des groupes oxo liés directement à l'hétérocycle, p. ex. piracétam, éthosuximide
• A61K 31/403 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à cinq chaînons avec un azote comme seul hétéro-atome d'un cycle, p. ex. sulpiride, succinimide, tolmétine, buflomédil condensés avec des carbocycles, p. ex. carbazole
• A61K 31/4035 - Isoindoles, p. ex. phtalimide
• A61K 31/4162 - 1,2-Diazoles condensés avec des systèmes hétérocycliques
• A61K 31/426 - 1,3-Thiazoles
• A61K 31/437 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle condensés en ortho ou en péri avec des systèmes hétérocycliques le système hétérocyclique contenant un cycle à cinq chaînons ayant l'azote comme hétéro-atome du cycle, p. ex. indolizine, bêta-carboline
• A61K 31/4375 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle condensés en ortho ou en péri avec des systèmes hétérocycliques le système hétérocyclique contenant un cycle à six chaînons ayant l'azote comme hétéro-atome du cycle, p. ex. quinolizines, naphtyridines, berbérine, vincamine
• A61K 31/44 - Pyridines non condenséesLeurs dérivés hydrogénés
• A61K 31/454 - Pipéridines non condensées, p. ex. pipérocaïne contenant d'autres systèmes hétérocycliques contenant un cycle à cinq chaînons avec l'azote comme hétéro-atome du cycle, p. ex. pimozide, dompéridone
• A61K 31/517 - PyrimidinesPyrimidines hydrogénées, p. ex. triméthoprime condensées en ortho ou en péri avec des systèmes carbocycliques, p. ex. quinazoline, périmidine
• A61K 31/519 - PyrimidinesPyrimidines hydrogénées, p. ex. triméthoprime condensées en ortho ou en péri avec des hétérocycles
• A61K 31/522 - Purines, p. ex. adénine ayant des groupes oxo liés directement à l'hétérocycle, p. ex. hypoxanthine, guanine, acyclovir
• A61K 31/5513 - 1,4-Benzodiazépines, p. ex. diazépam
• A61K 31/69 - Composés du bore
• A61K 38/00 - Préparations médicinales contenant des peptides
• A61K 38/08 - Peptides ayant de 5 à 11 amino-acides
• A61K 38/095 - Oxytocines Vasopressines Peptides apparentés
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p. ex. composés antiphlogistiques et pour le cœur
• A61P 43/00 - Médicaments pour des utilisations spécifiques, non prévus dans les groupes

Abrégé

Mechanisms for verifying software are provided, the mechanisms including: identifying a plurality of layers of code of the software including a lowest layer, a middle layer, and a highest layer; generating a low-level specification and an identical refinement proof for each of the plurality of layers using a hardware processor; generating a high-level specification and a lifting refinement proof for each of the plurality of layers; and verifying the software based on the low-level specifications, the identical refinement proofs, the high-level specifications, and the lifting refinement proofs. In some embodiments, one of the low-level specifications is generated using Fixedpoint construction. In some embodiments, one of the high-level specifications is generated by applying a set of transformation rules to one of the low-level specifications.

Classes IPC  ?

• G06F 21/57 - Certification ou préservation de plates-formes informatiques fiables, p. ex. démarrages ou arrêts sécurisés, suivis de version, contrôles de logiciel système, mises à jour sécurisées ou évaluation de vulnérabilité

Abrégé

An animal positioned on a perforated platform can be stimulated in an automated fashion. Images of the animal's paw are captured using a bottom-view camera positioned below the platform. Based on these images, an upwards-pointing tool is moved until it is directly beneath the paw. The animal is then stimulated automatically by moving the tool upwards to contact the paw, then moving it back down to cease the contact. Images of the animal are captured using at least one side-view camera, and these images can be analyzed to ascertain the animal's response to the stimulus.

Classes IPC  ?

• A61D 7/00 - Dispositifs ou méthodes pour l'introduction de remèdes, solides, liquides ou gazeux ou d'autres produits dans ou sur le corps des animaux
• G03B 17/56 - Accessoires
• H04N 23/695 - Commande de la direction de la caméra pour modifier le champ de vision, p. ex. par un panoramique, une inclinaison ou en fonction du suivi des objets
• H04N 23/74 - Circuits de compensation de la variation de luminosité dans la scène en influençant la luminosité de la scène à l'aide de moyens d'éclairage

Abrégé

Methods and compositions for treating a disease in a subject comprising administering an adoptive cell therapy (ACT) to the subject, the ACT comprising delivering a modified lymphocyte comprising a modified T cell receptor (TCR) or a chimeric antigen receptor (CAR); at least one inactivated endogenous TCRα chain allele; and at least one inactivated endogenous TCRβ chain allele.

Classes IPC  ?

• C07K 14/725 - Récepteurs de lymphocytes-T
• C12N 5/10 - Cellules modifiées par l'introduction de matériel génétique étranger, p. ex. cellules transformées par des virus

Abrégé

The present disclosure provides systems and methods for isolation of nucleic acids. In particular, provided herein are nanopore-based or substrate-based sequencing systems and methods of use thereof for isolation of desired nucleic acids from a mixed library containing both accurate and inaccurate strands.

Classes IPC  ?

• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN
• C12Q 1/6806 - Préparation d’acides nucléiques pour analyse, p. ex. pour test de réaction en chaîne par polymérase [PCR]
• C12Q 1/6869 - Méthodes de séquençage
• G16B 30/00 - TIC spécialement adaptées à l’analyse de séquences impliquant des nucléotides ou des aminoacides

Abrégé

The present disclosure provides, inter alia, a recombinant engineered deubiquitinase (DUB) and methods for treating or ameliorating an inherited ion channelopathy, such as long QT syndrome, Brugada syndrome, or cystic fibrosis, in a subject. Further provided are methods for screening mutations causing such inherited ion channelopathies for a trafficking-deficient mutation that is treatable by the recombinant engineered DUB disclosed herein.

Classes IPC  ?

• C12N 9/64 - Protéinases provenant de tissu animal, p. ex. rennine
• A61K 38/00 - Préparations médicinales contenant des peptides
• C12N 15/85 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes eucaryotes pour cellules animales
• C12Q 1/6883 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p. ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique

Abrégé

The present disclosure provides, inter alia, a recombinant engineered deubiquitinase (DUB) and methods for treating or ameliorating an inherited ion channelopathy, such as long QT syndrome, Brugada syndrome, or cystic fibrosis, in a subject. Further provided are methods for screening mutations causing such inherited ion channelopathies for a trafficking-deficient mutation that is treatable by the recombinant engineered DUB disclosed herein.

Classes IPC  ?

• C12N 9/64 - Protéinases provenant de tissu animal, p. ex. rennine
• A61K 38/00 - Préparations médicinales contenant des peptides
• C12N 15/85 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes eucaryotes pour cellules animales
• C12Q 1/6883 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p. ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique

Abrégé

A method for treating pancreatic cancer, comprising administering to a subject in need thereof a therapeutically effective amount DMPatA, or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount Class 1 HDAC inhibitor selected from the group consisting of romidepsin, entinostat, and chidamide.

Classes IPC  ?

• A61K 31/426 - 1,3-Thiazoles
• A61K 38/15 - DepsipeptidesLeurs dérivés
• A61K 9/08 - Solutions
• A61P 35/00 - Agents anticancéreux
• G01N 33/574 - Tests immunologiquesTests faisant intervenir la formation de liaisons biospécifiquesMatériaux à cet effet pour le cancer

Abrégé

The disclosed subject matter relates to a photonically integrated atomic tweezer clock. An example atomic tweezer clock can include a laser system, a holographic metasurface, a vacuum system, and a cold atoms source, wherein the holographic metasurface generates an optical tweezer array, and the atoms are trapped by the optical tweezer array in the vacuum system for generating an atomic tweezer clock. In certain embodiments, the laser system is integrated with frequency combs in chip-scale to ensure compactness and robustness.

Classes IPC  ?

• G21K 1/00 - Dispositions pour manipuler des particules ou des rayonnements ionisants, p. ex. pour focaliser ou pour modérer
• G04F 5/14 - Appareils pour la production d'intervalles de temps prédéterminés, utilisés comme étalons utilisant des horloges atomiques

Abrégé

An ultrasound phased array integrated in flexible CMOS technology is provided. The CMOS IC chip is fabricated through various chip-thinning techniques, resulting in mechanical flexibility, robustness, and minimized mechanical loading for the piezoelectric transducers. The ultrasound phased array CMOS patch can allow for the generation of high intensity focal regions for maximum penetration in regions of interest.

Classes IPC  ?

• A61B 8/00 - Diagnostic utilisant des ondes ultrasonores, sonores ou infrasonores
• A61N 7/00 - Thérapie par ultrasons

Abrégé

Methods to prevent, inhibit or treat a neurodegenerative disease, e.g., one having protein aggregates, as well as compositions useful in that regard, are provided.

Classes IPC  ?

• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61K 9/127 - Vecteurs à bicouches synthétiques, p. ex. liposomes ou liposomes comportant du cholestérol en tant qu’unique agent tensioactif non phosphatidylique
• A61K 38/17 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains
• A61P 25/28 - Médicaments pour le traitement des troubles du système nerveux des troubles dégénératifs du système nerveux central, p. ex. agents nootropes, activateurs de la cognition, médicaments pour traiter la maladie d'Alzheimer ou d'autres formes de démence

Abrégé

The disclosed subject matter provides systems and methods for predicting a spontaneous preterm birth based on transvaginal ultrasound images of a subject. An example method can include providing a preterm birth prediction model, obtaining one or more transvaginal ultrasound images of the subject, each including cervical features, determining measurements of a plurality of cervical structure features from the one or more ultrasound images, assessing, using the preterm birth prediction model, cervical health of the subject based on the measurements of the plurality of cervical structure features, and calculating the spontaneous preterm birth risk based on the assessed cervical health, using the preterm birth prediction model.

Classes IPC  ?

• A61B 8/12 - Diagnostic utilisant des ondes ultrasonores, sonores ou infrasonores dans des cavités ou des conduits du corps, p. ex. en utilisant des cathéters
• A61B 5/00 - Mesure servant à établir un diagnostic Identification des individus

Abrégé

The invention discloses PU7-1, pharmaceutical compositions comprising PU7-1, and methods of treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of PU7-1.

Classes IPC  ?

• A61K 31/517 - PyrimidinesPyrimidines hydrogénées, p. ex. triméthoprime condensées en ortho ou en péri avec des systèmes carbocycliques, p. ex. quinazoline, périmidine
• A61P 35/00 - Agents anticancéreux
• C07D 401/14 - Composés hétérocycliques contenant plusieurs hétérocycles comportant des atomes d'azote comme uniques hétéro-atomes du cycle, au moins un cycle étant un cycle à six chaînons avec un unique atome d'azote contenant au moins trois hétérocycles

Abrégé

Disclosed herein are methods of treating and/or prophylaxis of a disease or condition associated with cellular stress granule formation in a mammal via administration of small molecule compounds. Also disclosed herein are chemical compounds effective in treating diseases or conditions associated with aberrant cellular stress responses and/or stress granule formation.

Classes IPC  ?

• A61K 31/41 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à cinq chaînons avec plusieurs hétéro-atomes cycliques, l'un au moins étant l'azote, p. ex. tétrazole
• A61K 31/44 - Pyridines non condenséesLeurs dérivés hydrogénés
• A61K 31/519 - PyrimidinesPyrimidines hydrogénées, p. ex. triméthoprime condensées en ortho ou en péri avec des hétérocycles
• A61K 31/69 - Composés du bore
• G01N 33/68 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique faisant intervenir des protéines, peptides ou amino-acides

Abrégé

CAR Tregs and Tregs are provided which are both conversion-resistant and condition-resistant. The Treg cells are engineered such that they are deficient in or substantially devoid of a cell-surface marker or antigen.

Classes IPC  ?

• A61K 39/00 - Préparations médicinales contenant des antigènes ou des anticorps
• A61P 37/06 - Immunosuppresseurs, p. ex. médicaments pour le traitement du rejet de greffe
• C07K 16/28 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire
• C12N 5/0783 - Cellules TCellules NKProgéniteurs de cellules T ou NK
• C12N 9/22 - Ribonucléases
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 15/90 - Introduction stable d'ADN étranger dans le chromosome

Abrégé

Provided is a nebulizer device, the device including: a housing comprising a mouthpiece and a cover movable between a first position and a second position, the nebulizer device being configured to contain therein a liquid therapeutic formulation; and a vibratory nebulizer being disposed inside the housing and being in fluid communication with the liquid therapeutic formulation and the mouthpiece, the vibratory nebulizer optionally comprising a mesh, the vibratory nebulizer configured to nebulize the liquid therapeutic formulation into aerosolized particles in a range of 3 to 35 microns, optionally from about 10 to about 35 microns, and the device configured such that when the cover is in the first position the cover covers the mouthpiece and inactivates the nebulizer and when the cover is in the second position the mouthpiece is exposed to a user.

Abrégé

Salmonella typhimuriumSalmonella typhimurium comprising a first heterologous nucleic acid encoding a first polypeptide that causes bacterial lysis, a second heterologous nucleic acid encoding a second polypeptide that causes vacuolar lysis, and a third heterologous nucleic acid encoding a virus.

Abrégé

Introduce into a reactor a polyurethane having a benzylic linkage. In one aspect, induce a chemical reduction through a reducing agent and a catalyst to depolymerize the polyurethane having the benzylic linkage. In another aspect, introduce hydrogen bromide into the reactor, and react the polyurethane with the hydrogen bromide to recover constituents of the polyurethane via acid-catalyzed bromine-substitution to cleave the benzylic linkage of the polyurethane.

Classes IPC  ?

• C08J 11/16 - Récupération ou traitement des résidus des polymères par coupure des chaînes moléculaires des polymères ou rupture des liaisons de réticulation par voie chimique, p. ex. dévulcanisation par traitement avec une substance inorganique

Abrégé

Systems, methods and devices for profiling phenotypes of cells, and associated methods for identifying or predicting drug mechanism of action, discovering drug candidates with novel mechanisms of actions, differential subpopulation responses to drugs, and novel IR vibrational probes.

Abrégé

Disclosed herein is a computational algorithm that statistically infer a PPR code (preference of a PPR motif for a nucleotide base) while matching PPR proteins with their targets accurately without requiring experimental pairing information. From comprehensive lists of PLS-type PPR proteins and editing sites from more than 1500 PPRs, the algorithm derived a quantitative code including novel amino acid combinations in key positions that confer high specificity. For example, the predicted targets suggests that the recently identified DYW:KP domain is unequivocally responsible for the poorly characterized reverse U-to-C editing.

Abrégé

Methods for generating mature neurons differentiated from pluripotent stem cells, such as to facilitate the study of late-onset neurodegenerative disease, are disclosed. The methods include overexpressing the splicing factor muscleblind like splicing regulator 2 (Mbnl2) in cortical neurons. In some aspects, the method further comprises overexpressing RNA binding fox-1 homolog 1 (Rbfox1) and/or reducing expression of polypyrimidine tract binding proteins PTBP1/2. The methods also include accelerated derivation of mature neuron and generation of a tau pathology model. Also disclosed are constructs and compositions for accelerated derivation of mature neuron and/or generation of a tau pathology model.

Classes IPC  ?

• C12N 5/0793 - Neurones
• C07K 14/47 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains provenant de vertébrés provenant de mammifères
• C12N 15/867 - Vecteurs rétroviraux

Abrégé

Provided is a building material, comprising: a base material and an amount of aragonite, the aragonite optionally present at up to about 60 wt% of the total weight of the base material and the aragonite. The base material can include any one or more of a cementitious material, a clay, a biopolymer, gypsum, and lime. The disclosed materials are useful in manufacturing processes, including additive manufacturing and other construction processes.

Classes IPC  ?

• C01F 11/18 - Carbonates
• C04B 7/345 - Ciments hydrauliques non prévus par l'un des groupes

Abrégé

Systems, methods, and devices for generating tunable low frequency signals, such as microwave and radiofrequency signals are disclosed. A first waveguide in optical communication with a first ring resonator can be configured to receive a light input and generate frequencies via optical parametric oscillation. A second waveguide with second ring resonator can receive the frequencies and optically synchronize the frequencies via optical frequency division to generate a low frequency signal. One or more heating elements can be connected to each ring resonator to tune the resonators and reduce noise associated with the low frequency signal.

Classes IPC  ?

• G02F 1/39 - Optique non linéaire pour la génération ou l'amplification paramétrique de la lumière, des infrarouges ou des ultraviolets
• G02F 1/01 - Dispositifs ou dispositions pour la commande de l'intensité, de la couleur, de la phase, de la polarisation ou de la direction de la lumière arrivant d'une source lumineuse indépendante, p. ex. commutation, ouverture de porte ou modulationOptique non linéaire pour la commande de l'intensité, de la phase, de la polarisation ou de la couleur

Abrégé

A system may mitigate leakage currents in charging stations for electric vehicles. The system may include a bank of one or more parallel capacitors per phase electrically coupled to an AC voltage source, wherein a neutral point of the one or more parallel capacitors is electrically coupled to a DC ground; a bank of one or more inductors per phase electrically coupled to the one or more parallel capacitors, wherein each inductor is in series with and downstream from one capacitor; a rectifier electrically coupled to and downstream from the one or more parallel inductors, wherein the rectifier converts the AC voltage source to a DC voltage for supply to a battery; a DC bus electrically coupled to the rectifier; and a controller, wherein the controller is configured to mitigate leakage currents by controlling a voltage of at least one of the bank of one or more parallel capacitors.

Classes IPC  ?

• H02J 7/00 - Circuits pour la charge ou la dépolarisation des batteries ou pour alimenter des charges par des batteries
• B60L 53/30 - Détails de construction des stations de charge
• H02J 7/06 - Régulation du courant ou de la tension de charge utilisant des tubes à décharge ou des dispositifs à semi-conducteurs
• H02M 1/44 - Circuits ou dispositions pour corriger les interférences électromagnétiques dans les convertisseurs ou les onduleurs
• H02M 3/158 - Transformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant continu sans transformation intermédiaire en courant alternatif par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande utilisant uniquement des dispositifs à semi-conducteurs avec commande automatique de la tension ou du courant de sortie, p. ex. régulateurs à commutation comprenant plusieurs dispositifs à semi-conducteurs comme dispositifs de commande finale pour une charge unique
• H02M 7/219 - Transformation d'une puissance d'entrée en courant alternatif en une puissance de sortie en courant continu sans possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande utilisant uniquement des dispositifs à semi-conducteurs dans une configuration en pont

Abrégé

Provided herein are heterocyclic derivative compounds and pharmaceutical compositions comprising said compounds that are useful for the treatment of retinal binding protein (RBP4) related diseases, such as obesity and the like.

Classes IPC  ?

• A61K 31/4545 - Pipéridines non condensées, p. ex. pipérocaïne contenant d'autres systèmes hétérocycliques contenant un cycle à six chaînons avec l'azote comme hétéro-atome du cycle, p. ex. pipampérone, anabasine
• A61K 9/00 - Préparations médicinales caractérisées par un aspect particulier
• A61K 31/4985 - Pyrazines ou pipérazines condensées en ortho ou en péri avec des systèmes hétérocycliques
• A61K 31/519 - PyrimidinesPyrimidines hydrogénées, p. ex. triméthoprime condensées en ortho ou en péri avec des hétérocycles
• A61K 31/5365 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec au moins un azote et au moins un oxygène comme hétéro-atomes d'un cycle, p. ex. 1,2-oxazines condensées en ortho ou en péri avec des systèmes hétérocycliques
• A61K 31/5383 - 1,4-Oxazines, p. ex. morpholine condensées en ortho ou en péri avec des systèmes hétérocycliques
• A61P 3/04 - AnorexigènesMédicaments de l'obésité
• A61P 3/10 - Médicaments pour le traitement des troubles du métabolisme de l'homéostase du glucose de l'hyperglycémie, p. ex. antidiabétiques

Abrégé

A plurality of modules are simultaneously positioned at locations that correspond to different angiosomes. Each of these modules has a front surface shaped and dimensioned for contacting a person's skin, a plurality of different-wavelength light sources aimed in a forward direction, and a plurality of light detectors aimed to detect light arriving from in front of the front surface. Each module is supported by a support structure (e.g., a strap or a clip) that is shaped and dimensioned to hold the front surface adjacent to the person's skin at a respective position. Perfusion in each of the angiosomes is monitored using these modules, and the surgeon can rely on this information to guide his or her intervention.

Classes IPC  ?

• A61B 5/026 - Mesure du débit sanguin
• A61B 5/00 - Mesure servant à établir un diagnostic Identification des individus
• A61B 5/02 - Détection, mesure ou enregistrement en vue de l'évaluation du système cardio-vasculaire, p. ex. mesure du pouls, du rythme cardiaque, de la pression sanguine ou du débit sanguin
• A61B 5/021 - Mesure de la pression dans le cœur ou dans les vaisseaux sanguins
• A61B 5/022 - Mesure de la pression dans le cœur ou dans les vaisseaux sanguins par application d'une pression pour fermer les vaisseaux sanguins, p. ex. contre la peauOphtalmodynamomètres
• A61B 5/0225 - Mesure de la pression dans le cœur ou dans les vaisseaux sanguins par application d'une pression pour fermer les vaisseaux sanguins, p. ex. contre la peauOphtalmodynamomètres la pression étant commandée par des signaux électriques, p. ex. dérivés des bruits de Korotkoff
• A61B 5/0245 - Mesure du pouls ou des pulsations cardiaques utilisant des capteurs engendrant des signaux électriques
• A61B 5/1455 - Mesure des caractéristiques du sang in vivo, p. ex. de la concentration des gaz dans le sang ou de la valeur du pH du sang en utilisant des capteurs optiques, p. ex. des oxymètres à photométrie spectrale

Abrégé

Disclosed herein is a biochip with a plurality of endothelial cells (e.g., Schlemm's canal cells) having a plurality of pores (e.g., transcellular pores) and methods of making and using the same.

Classes IPC  ?

• B01L 3/00 - Récipients ou ustensiles pour laboratoires, p. ex. verrerie de laboratoireCompte-gouttes
• C12N 5/00 - Cellules non différenciées humaines, animales ou végétales, p. ex. lignées cellulairesTissusLeur culture ou conservationMilieux de culture à cet effet
• C12N 5/071 - Cellules ou tissus de vertébrés, p. ex. cellules humaines ou tissus humains