Abrégé

System, apparatus, method and computer-accessible medium according to exemplary embodiments of the present disclosure which facilitate accessible, data-driven neuroimaging. Exemplary embodiment of the present disclosure provides for a magnet, a gradient, and spectrometer technology that can be contained in an imaging suite that can be affordably manufactured, delivered, and operated anywhere in the world by a trained field nurse. Exemplary networks of these field-deployed MR suites can be tethered to a remote resource base such as a hospital through satellite links to a cloud platform. In exemplary embodiments, massive amounts of heterogeneous data can be collected from diverse populations in a standardized way and archived for machine learning approaches to permit model-based inference generation.

Classes IPC  ?

• G01R 33/56 - Amélioration ou correction de l'image, p. ex. par des techniques de soustraction ou d'établissement de moyenne
• A61B 5/055 - Détection, mesure ou enregistrement pour établir un diagnostic au moyen de courants électriques ou de champs magnétiquesMesure utilisant des micro-ondes ou des ondes radio faisant intervenir la résonance magnétique nucléaire [RMN] ou électronique [RME], p. ex. formation d'images par résonance magnétique
• G01R 33/36 - Détails électriques, p. ex. adaptations ou couplage de la bobine au récepteur
• G01R 33/38 - Systèmes pour produire, homogénéiser ou stabiliser le champ magnétique directeur ou le champ magnétique à gradient
• G01R 33/3815 - Systèmes pour produire, homogénéiser ou stabiliser le champ magnétique directeur ou le champ magnétique à gradient utilisant des électro-aimants avec des bobines supraconductrices, p. ex. leurs alimentations
• G01R 33/54 - Systèmes de traitement du signal, p. ex. utilisant des séquences d'impulsions
• G06N 20/00 - Apprentissage automatique
• G06T 7/00 - Analyse d'image

Abrégé

Methods and compositions that treat Alzheimer's disease and other neurodegenerative diseases and/or to ameliorate or improve symptoms associated with Alzheimer's disease. In some aspects, the compositions and methods use a serotonin 4 receptor (5-hydroxytryptamine (serotonin) receptor 4, or 5-HT4R) agonist in combination with: (R,S)-ketamine, a (R,S)-ketamine analog, or a pharmaceutically acceptable salt, derivative, or metabolite thereof; an antagonist of the glutamate N-methyl-D-aspartate (NMDA) receptor (NMDAR); or an agonist of the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR).

Classes IPC  ?

• A61K 31/513 - PyrimidinesPyrimidines hydrogénées, p. ex. triméthoprime ayant des groupes oxo liés directement à l'hétérocycle, p. ex. cytosine
• A61K 9/00 - Préparations médicinales caractérisées par un aspect particulier
• A61K 31/135 - Amines, p. ex. amantadine ayant des cycles aromatiques, p. ex. méthadone
• A61K 31/401 - ProlineSes dérivés, p. ex. captopril
• A61K 31/42 - Oxazoles
• A61K 31/4245 - Oxadiazoles
• A61K 31/4525 - Pipéridines non condensées, p. ex. pipérocaïne contenant d'autres systèmes hétérocycliques contenant un cycle à cinq chaînons avec l'oxygène comme hétéro-atome du cycle
• A61K 31/453 - Pipéridines non condensées, p. ex. pipérocaïne contenant d'autres systèmes hétérocycliques contenant un cycle à six chaînons avec l'oxygène comme hétéro-atome du cycle
• A61K 31/454 - Pipéridines non condensées, p. ex. pipérocaïne contenant d'autres systèmes hétérocycliques contenant un cycle à cinq chaînons avec l'azote comme hétéro-atome du cycle, p. ex. pimozide, dompéridone
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p. ex. composés antiphlogistiques et pour le cœur
• A61P 25/28 - Médicaments pour le traitement des troubles du système nerveux des troubles dégénératifs du système nerveux central, p. ex. agents nootropes, activateurs de la cognition, médicaments pour traiter la maladie d'Alzheimer ou d'autres formes de démence

Abrégé

Medical devices having engineered mechanically functional cartilage from adult human mesenchymal stem cells and method for making same.

Classes IPC  ?

• A61L 27/36 - Matériaux pour prothèses ou pour revêtement de prothèses contenant des constituants de constitution indéterminée ou leurs produits réactionnels
• A61F 2/30 - Articulations
• A61L 27/38 - Cellules animales
• A61L 27/42 - Matériaux composites, c.-à-d. en couches ou contenant un matériau dispersé dans une matrice constituée d'un matériau analogue ou différent comportant une matrice inorganique
• A61L 27/46 - Matériaux composites, c.-à-d. en couches ou contenant un matériau dispersé dans une matrice constituée d'un matériau analogue ou différent comportant une matrice macromoléculaire avec des charges inorganiques contenant du phosphore
• A61L 27/50 - Matériaux caractérisés par leur fonction ou leurs propriétés physiques
• A61L 27/56 - Matériaux poreux ou cellulaires

Abrégé

The present disclosure provides methods for modifying an aptamer to change the affinity of a modified aptamer to a ligand or produce a modified aptamer having a desired half-point of response value. Also disclosed are modified aptamers produced by the methods disclosed herein, and aptamers that bind to specific ligands or target molecules. Additionally provided are electrochemical sensors comprising one or more of the disclosed aptamers.

Classes IPC  ?

• C12N 15/115 - Aptamères, c.-à-d. acides nucléiques liant spécifiquement une molécule cible avec une haute affinité sans s'y hybrider
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN
• G01N 33/53 - Tests immunologiquesTests faisant intervenir la formation de liaisons biospécifiquesMatériaux à cet effet

Abrégé

The present disclosure provides to systems, methods, and compositions for rescuing protein misfolding and preventing protein aggregation. Particularly the present disclosure provides methods and compositions comprising DNAJB6 or variants thereof, or polynucleotides encoding DNAJB6 or variants thereof. The present disclosure also provides methods for treating protein misfolding and/or protein aggregation diseases (e.g., multiple amyotrophic lateral sclerosis and frontotemporal dementia) by administering the systems or compositions to a subject in need thereof.

Classes IPC  ?

• A61K 38/17 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains
• A61P 25/28 - Médicaments pour le traitement des troubles du système nerveux des troubles dégénératifs du système nerveux central, p. ex. agents nootropes, activateurs de la cognition, médicaments pour traiter la maladie d'Alzheimer ou d'autres formes de démence

Abrégé

Systemic lupus erythematosus (SLE) can be diagnosed by affixing a plurality of light sources and a plurality of light detectors against the subject's body near a joint, and sequentially transmitting light from each of the plurality of light sources into the subject's body. Signals are acquired from each of the plurality of light detectors. The rise time of the acquired signals that occurs in response to an inflation of a pressure cuff is determined, and an indication of whether the joint is affected by SLE is made based on the determined rise time. In some embodiments, a plateau time of the acquired signals is also acquired, and the indication of whether the joint is affected by SLE is made based on the determined rise time and the determined plateau time.

Classes IPC  ?

• A61B 5/00 - Mesure servant à établir un diagnostic Identification des individus
• A61B 5/026 - Mesure du débit sanguin

Abrégé

Systems and methods for performing non-destructive sensing of a cell or tissue, in vivo or in culture, are provided. The disclosed systems and methods include fabricating and powering one or more implantable integrated circuit (IC) chips that include a network of Photovoltaic (PV) cells for energy harvesting from an optical energy source, an optical modulator integrating Quantum Dot capacitors (QD-caps) for optical data transfer using fluorescence modulation, and sensing circuitry. The IC chip disclosed herein can measure a thickness of around 10 μm, allowing injection into small cells and diffusion through tissue, it is powered and imaged under a microscope and communicates using fluorescence modulation imaged under a microscope.

Classes IPC  ?

• G01N 21/64 - FluorescencePhosphorescence
• A61B 5/00 - Mesure servant à établir un diagnostic Identification des individus
• G02F 1/015 - Dispositifs ou dispositions pour la commande de l'intensité, de la couleur, de la phase, de la polarisation ou de la direction de la lumière arrivant d'une source lumineuse indépendante, p. ex. commutation, ouverture de porte ou modulationOptique non linéaire pour la commande de l'intensité, de la phase, de la polarisation ou de la couleur basés sur des éléments à semi-conducteurs ayant des barrières de potentiel, p. ex. une jonction PN ou PIN
• G02F 1/025 - Dispositifs ou dispositions pour la commande de l'intensité, de la couleur, de la phase, de la polarisation ou de la direction de la lumière arrivant d'une source lumineuse indépendante, p. ex. commutation, ouverture de porte ou modulationOptique non linéaire pour la commande de l'intensité, de la phase, de la polarisation ou de la couleur basés sur des éléments à semi-conducteurs ayant des barrières de potentiel, p. ex. une jonction PN ou PIN dans une structure de guide d'ondes optique
• H10F 77/40 - Éléments ou dispositions optiques

Abrégé

inter aliainter alia, compositions and methods for improved therapeutic vectors for targeting brain microvasculature and employing such vectors to treat brain diseases.

Classes IPC  ?

• A61K 35/76 - VirusParticules sous-viralesBactériophages
• A61K 38/17 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains
• A61P 25/00 - Médicaments pour le traitement des troubles du système nerveux
• C07K 14/705 - RécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• C12N 15/864 - Vecteurs parvoviraux
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique

Abrégé

Treatment of females that experience social isolation-induced anxiety includes administration of an agent that blocks or reduces AVPR1A signaling in the subject. Such agents may interfere with AVPR1A in the amygdala, or specifically in the central nucleus of the amygdala (CeA). Treatment may be administered by injection or by chemogenetic approaches. Compounds that block AVPR1A signaling may be used to accomplish such treatment. Useful compounds include, for example, AVPR1A antagonists such as SRX246.

Classes IPC  ?

• A61K 31/4545 - Pipéridines non condensées, p. ex. pipérocaïne contenant d'autres systèmes hétérocycliques contenant un cycle à six chaînons avec l'azote comme hétéro-atome du cycle, p. ex. pipampérone, anabasine
• A61P 25/22 - Anxiolytiques

Abrégé

2222222O (R2).

Classes IPC  ?

• B01D 53/46 - Élimination des composants de structure définie
• C25B 1/02 - Hydrogène ou oxygène
• B01D 53/62 - Oxydes de carbone
• B01D 53/34 - Épuration chimique ou biologique des gaz résiduaires

Abrégé

Provided here are methods to prevent, inhibit or treat an autoimmune disease or a vascular or cardiovascular disorder in a mammal, comprising administering to the mammal a composition comprising an effective amount of isolated nucleic acid comprising a nucleotide sequence encoding WDFY3/Alfy or a portion thereof, a nucleotide sequence comprising a WDFY3/Alfy-specific long non-coding RNA (lncRNA) or a corresponding DNA sequence, a nucleotide sequence comprising a portion of a lncRNA WDFY3-AS2 or a corresponding DNA sequence, or isolated WDFY3/Alfy or a portion thereof.

Classes IPC  ?

• A61K 38/17 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains
• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 37/06 - Immunosuppresseurs, p. ex. médicaments pour le traitement du rejet de greffe

Abrégé

Exemplary systems, methods, and apparatuses are provided for generating at least one periodically poled layered compound. Exemplary systems, methods, and apparatuses according to an exemplary embodiment of the present disclosure can include patterning a plurality of slabs of layered compounds and stacking the plurality of slabs with each slab twisted relative to each adjacent slab.

Classes IPC  ?

• H10H 20/814 - Corps ayant des moyens réfléchissants, p. ex. des réflecteurs de Bragg en semi-conducteurs
• H10H 20/01 - Fabrication ou traitement

Abrégé

Methods for prophylactically treating a stress-induced affective disorder or stress-induced psychopathology in a subject are provided. Also provided are methods for inducing and/or enhancing stress resilience in a subject. In certain embodiments, an effective amount of (R,S)-ketamine or (2R,6R)-hydroxynorketamine ((2R,6R)-HNK) is administered to a female or male subject prior to a stressor.

Classes IPC  ?

• A61K 31/135 - Amines, p. ex. amantadine ayant des cycles aromatiques, p. ex. méthadone
• A61K 9/00 - Préparations médicinales caractérisées par un aspect particulier
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p. ex. composés antiphlogistiques et pour le cœur
• A61P 25/24 - Antidépresseurs

Abrégé

One aspect of the invention provides a method of treating a cornea. The method includes controlling a light source to apply light energy pulses to a single corneal layer selected from the group consisting of: an anterior corneal layer and a posterior corneal layer. The light energy pulses are below an optical breakdown threshold for the cornea and ionize water molecules within the treated corneal layer to generate reactive oxygen species that cross-link collagen within the single corneal layer. Another aspect of the invention provides a method of treating a cornea. The method includes controlling a light source to apply light energy pulses to at least a corneal stroma layer of a cornea. The light energy pulses are below an optical breakdown threshold for the cornea and ionize water molecules within the treated corneal stromal layer to generate reactive oxygen species that cross-link collagen within the cornea.

Classes IPC  ?

• A61F 9/008 - Procédés ou dispositifs pour la chirurgie de l'œil utilisant un laser

Abrégé

The disclosed matter provides a Contorted Macromolecular Ladders for Fast-charging and Long-Life Lithium Batteries, and the method thereof. By tuning the length of hPDI[n], the electrical and ionic conductivity of the resulting contorted macromolecular ladders can be modulated for improving the lithium-ion coordination and transport. The materials can be applied into organic battery electrode materials which are sustainable, fast-charging, and long lasting.

Classes IPC  ?

• H01M 4/137 - Électrodes à base de polymères électro-actifs
• H01M 4/02 - Électrodes composées d'un ou comprenant un matériau actif
• H01M 10/0525 - Batteries du type "rocking chair" ou "fauteuil à bascule", p. ex. batteries à insertion ou intercalation de lithium dans les deux électrodesBatteries à l'ion lithium

Abrégé

Systems and methods are provided for generating amodal images from occlusions objects in input images. Examples herein include receiving a prompt selecting an object in an input image; applying the input image to a trained conditional generative model that generates an amodal image of the selected object based on the prompt and the input image; and outputting the amodal image.

Classes IPC  ?

• G06T 11/60 - Édition de figures et de texteCombinaison de figures ou de texte
• G06T 5/50 - Amélioration ou restauration d'image utilisant plusieurs images, p. ex. moyenne ou soustraction
• G06T 5/70 - DébruitageLissage
• G06T 7/12 - Découpage basé sur les bords
• G06V 10/26 - Segmentation de formes dans le champ d’imageDécoupage ou fusion d’éléments d’image visant à établir la région de motif, p. ex. techniques de regroupementDétection d’occlusion

Abrégé

A microbial cellulose material is provided comprising an acid, a metal ion, and microbial cellulose. The acid can be a polyphenol. The metal ion can be selected from a group consisting of iron ion (Fe2+), iron ion (Fe3+), copper ion (Cu2+), aluminum ion (Al3+), magnesium ion (Mg2+), zinc ion (Zn2+), nickel ion (Ni2+), germanium ion (Ge4+), titanium (Ti4+), molybdenum (Mo6+) and tungsten ion (W6+). The microbial cellulose can be a bioplasticized microbial cellulose.

Classes IPC  ?

• D06M 13/00 - Traitement des fibres, fils, filés, tissus ou articles fibreux faits de ces matières, avec des composés organiques non macromoléculairesUn tel traitement combiné avec un traitement mécanique
• D06M 16/00 - Traitement biochimique des fibres, fils, filés, tissus ou articles fibreux faits de ces matières, p. ex. enzymatique
• D21H 11/16 - Pâte ou papier comprenant des fibres de cellulose ou de lignocellulose uniquement d'origine naturelle modifiés par un post-traitement particulier

Abrégé

Anti-TMEM106B( 120-254) aggregate antibodies, antibody fragments or fusion proteins are provided and methods of treating dementias, including Frontotemporal Lobar Degeneration, using anti-TMEM106B(120-254) aggregate antibodies, antibody fragments or fusion proteins.

Abrégé

Compounds for inhibiting cGAS having the following structure (I) and methods of use thereof.

Classes IPC  ?

• A61K 31/395 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines
• A61K 31/404 - Indoles, p. ex. pindolol
• A61K 31/33 - Composés hétérocycliques

Abrégé

The present disclosure provides systems, methods, and compositions for modifying a target nucleic acid. Particularly, the present invention relates to a polypeptide comprising a single subunit of a reverse transcriptase and a sequence-specific nuclease for use in prime-editing modification of a nucleic acid.

Classes IPC  ?

• C12N 15/90 - Introduction stable d'ADN étranger dans le chromosome
• C12N 9/12 - Transférases (2.) transférant des groupes contenant du phosphore, p. ex. kinases (2.7)
• C12N 9/22 - Ribonucléases
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées

Abrégé

This disclosure to the methods for nucleic acid modification, gene targeting, and gene tagging comprising an engineered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated transposon (CAST) system with a donor DNA comprising at least one engineered transposon end sequence and/or at least one integration co-factor protein. More particularly, the present disclosure provides systems comprising: an engineered CAST system or one or more nucleic acids encoding the engineered CAST system, wherein the CAST system comprises at least one or all of: i) at least one Cas protein, ii) one or more transposon-associated proteins, iii) at least one guide RNA (gRNA) complementary to at least a portion of a target nucleic acid sequence; and a donor nucleic acid comprising a cargo nucleic acid sequence flanked by at least one engineered transposon end sequence and/or at least one integration co-factor protein, or a nucleic acid encoding thereof.

Classes IPC  ?

• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 9/22 - Ribonucléases
• C12N 15/90 - Introduction stable d'ADN étranger dans le chromosome

Abrégé

The present disclosure relates to novel compounds and pharmaceutical compositions thereof, and methods for promoting healthy aging of skin, the treatment of skin disorders, the treatment of cardiovascular disorders, the treatment of renal disorders, the treatment of angiogenesis disorders, such as cancer, treatment of tissue damage, such as non-cardiac tissue damage, the treatment of evolving myocardial infarction, the treatment of ischemic injury, and the treatment of various other disorders, such as complications arising from diabetes with the compounds and compositions of the invention. Other disorders can include, but are not limited to, atherosclerosis, coronary artery disease, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, diabetic cardiomyopathy, infections of the skin, peripheral vascular disease, stroke, asthma, and the like.

Classes IPC  ?

• C07D 495/04 - Systèmes condensés en ortho
• A61P 9/10 - Médicaments pour le traitement des troubles du système cardiovasculaire des maladies ischémiques ou athéroscléreuses, p. ex. médicaments antiangineux, vasodilatateurs coronariens, médicaments pour le traitement de l'infarctus du myocarde, de la rétinopathie, de l'insuffisance cérébro-vasculaire, de l'artériosclérose rénale
• A61P 13/12 - Médicaments pour le traitement des troubles du système urinaire des reins
• A61P 17/00 - Médicaments pour le traitement des troubles dermatologiques
• A61P 25/02 - Médicaments pour le traitement des troubles du système nerveux des neuropathies périphériques

Abrégé

Training neural network(s) (NN(s)) to solve optimization problem (OP) includes: configuring a first NN of the NN(s) with a first set of (FSO) values for NN parameters (NNPs); selecting a FSO training samples (TSs) for training the NN(s); providing the FSO TSs and a FSO first variables to the first NN to produce a FSO first output variables (OVs); evaluating an OP-performance-measuring objective function (OF) based on the FSO TSs and the FSO first OVs to provide a first value of (VO) a performance metric (FVOPM) of the NN(s); updating the NNPs based on the FVOPM; selecting a second set of (SSO) TSs for training the NN(s); providing the SSO TSs and the FSO first OVs to the first NN to produce a SSO first OVs; evaluating the OF based on the SSO TSs and the SSO first OVs to provide a second VO the PM of the NN(s); and updating the NNPs based on the second VO the PM.

Classes IPC  ?

• G06N 3/08 - Méthodes d'apprentissage

Abrégé

Biological cells can be identified and recovered from a sample by pumping the sample through a flow channel so that the sample flows through the flow channel with a non-turbulent flow (e.g., a laminar flow). A plurality of images of the sample are captured as the sample passes through the flow channel. These images are analyzed to determine which portions of the sample include a target biological cell. Portions of the sample that were determined to include a target biological cell are routed into at least one first container, and portions of the sample that were not determined to include a target biological cell are routed to at least one second destination (e.g., one or more second containers).

Classes IPC  ?

• G01N 15/14 - Techniques de recherche optique, p. ex. cytométrie en flux
• B01L 3/00 - Récipients ou ustensiles pour laboratoires, p. ex. verrerie de laboratoireCompte-gouttes
• G01N 15/10 - Recherche de particules individuelles
• G01N 15/1434 - Dispositions optiques
• G01N 15/149 - Techniques de recherche optique, p. ex. cytométrie en flux spécialement adaptées au tri des particules, p. ex. selon leur taille ou leurs propriétés
• G06V 10/82 - Dispositions pour la reconnaissance ou la compréhension d’images ou de vidéos utilisant la reconnaissance de formes ou l’apprentissage automatique utilisant les réseaux neuronaux
• G06V 20/69 - Objets microscopiques, p. ex. cellules biologiques ou pièces cellulaires

Abrégé

Single-nucleotide variants (SNVs) in key T cell genes can drive clinical pathologies and could be repurposed to improve cellular cancer immunotherapies. Here, we perform massively parallel base editing screens to generate thousands of variants at gene loci annotated with known or potential clinical significance. We discover a broad landscape of putative gain- (GOF) and loss-of-function (LOF) mutations, including in PIK3CD and its regulatory subunit PIK3R1, LCK, SOS, AKT1, and RHOA. Base editing of PIK3CD and PIK3R1 variants in T cells with an engineered T cell receptor specific against a melanoma epitope or in different generations of CD19 chimeric antigen receptor T (CAR-T) cells demonstrates that discovered GOF variants, but not LOF or silent mutation controls, enhanced signaling, cytokine production and lysis of cognate melanoma and leukemia cell models, respectively. Additionally, we show that generations of CD19 CAR-T cells engineered with PIK3CD GOF mutations demonstrate enhanced antigen-specific signaling, cytokine production, and leukemia cell killing, including when benchmarked against other recent strategies.

Classes IPC  ?

• C12N 9/12 - Transférases (2.) transférant des groupes contenant du phosphore, p. ex. kinases (2.7)
• C12N 5/0783 - Cellules TCellules NKProgéniteurs de cellules T ou NK
• A61K 35/17 - LymphocytesLymphocytes BLymphocytes TCellules tueuses naturellesLymphocytes activés par un interféron ou une cytokine
• A61K 35/00 - Préparations médicinales contenant des substances ou leurs produits de réaction de constitution non déterminée
• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN

Abrégé

Provided herein at microneedles that include a base; one or more extensions, such as wings; a body; and a tip, which tip can, in some embodiments, be curved. The design allows the user to align the microneedle parallel with the blood vessel into which the microneedle is inserted, as the one or more extensions can stabilize the microneedle when inserted and also oppose excessively deep insertion of the microneedle. The disclosed design enables injections and aspirations to be made in a minimally damaging fashion, thereby enabling improved cannulation of blood vessels in the retina. The microneedles can be used, for example, to remove occlusions in these blood vessels by injecting an agent or by simply applying hydrodynamic forces, as well as selective treatment of intraocular tumors by microablation or infusion of chemotherapeutic agents.

Classes IPC  ?

• A61M 1/00 - Dispositifs de succion ou de pompage à usage médicalDispositifs pour retirer, traiter ou transporter les liquides du corpsSystèmes de drainage

Abrégé

Systems, methods and devices for determining the identity of one or more nano-particles that share a defined set of spectral features above a detection limit, comprising obtaining SRS spectrum data from a multiphoton laser scanning microscope configured to perform hyperspectral stimulated Raman scattering microscopy; generating, by the machine learning module trained using a training set, the identity of one or more particles, based on the SRS spectrum data wherein the training set comprises real and/or synthetic data of SRS spectra, associated with respective particle identities and based on bulk standard spectra, estimated frequency uncertainty, and estimated instrumental noise wherein the machine learning module generates the particle identity based on respective spectral matching coefficients (SMC SRS) of the detected SRS spectrum data obtained and from the training set.

Classes IPC  ?

• G01N 21/65 - Diffusion de Raman
• G01J 3/44 - Spectrométrie RamanSpectrométrie par diffusion
• G02B 21/00 - Microscopes

Abrégé

The present disclosure provides systems, compositions, methods, and kits, for guided DNA synthesis and genome engineering. Particularly, the present disclosure provides systems, compositions, methods, and kits comprising a defense-associated reverse transcriptase (DRT), or a nucleic acid encoding thereof, and an engineered target nucleic acid comprising one or more sequence of interest, or a nucleic acid encoding thereof.

Classes IPC  ?

• C12N 9/78 - Hydrolases (3.) agissant sur les liaisons carbone-azote autres que les liaisons peptidiques (3.5)
• C12N 5/10 - Cellules modifiées par l'introduction de matériel génétique étranger, p. ex. cellules transformées par des virus
• C12N 9/22 - Ribonucléases

Abrégé

Provided herein are methods of measuring vesicular leakage utilizing a fluorescent false neurotransmitter and methods of identifying a compound that modulates vesicular leakage utilizing a fluorescent false neurotransmitter.

Classes IPC  ?

• G01N 21/64 - FluorescencePhosphorescence
• G01N 33/50 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique

Abrégé

Methods and compositions for improving fertility or treating age-related infertility are disclosed. Specifically, the disclosure provides a method for improving fertility or treating infertility in a subject comprising administering to the subject an amount of capsids comprising PNMA1 and/or PNMA4 effective to improve fertility or treat infertility in a subject. Further disclosed is a method of making a pharmaceutical composition for treating infertility or subfertility in a subject comprising isolating from a biological sample capsids comprising PNMA1 and/or PNMA4 and admixing the capsids with a pharmaceutically acceptable carrier.

Classes IPC  ?

• A61K 38/00 - Préparations médicinales contenant des peptides
• A61P 15/08 - Médicaments pour le traitement des troubles génitaux ou sexuelsContraceptifs pour les troubles gonadiques ou pour augmenter la fertilité, p. ex. inducteurs d'ovulation ou de spermatogénèse
• C07K 1/14 - ExtractionSéparationPurification
• C07K 14/00 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés
• C07K 1/00 - Procédés généraux de préparation de peptides
• C07H 21/04 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques avec le désoxyribosyle comme radical saccharide
• C12N 15/00 - Techniques de mutation ou génie génétiqueADN ou ARN concernant le génie génétique, vecteurs, p. ex. plasmides, ou leur isolement, leur préparation ou leur purificationUtilisation d'hôtes pour ceux-ci

Abrégé

The bio-microbur therapeutic delivery platform is a three-dimensional (3D)-oriented nanoneedle platform shaped like a microscale version of a fruit bur. The bio-microbur may be used for drug delivery and other biological applications, including without limitation delivery of oral vaccines or other oral biologics. Similar to a fruit bur's ability to adhere to different surfaces, the bio-microbur therapeutic delivery platform adheres to biological tissue, cell membranes, and biological gels. The bio-microbur therapeutic delivery platform includes a core and a plurality of nanoneedles secured to the core and extending outwardly therefrom, adapted for carrying and delivering a therapeutic agent. The treating agent may be an SSRI, such as fluoxetine.

Classes IPC  ?

• A61K 9/00 - Préparations médicinales caractérisées par un aspect particulier
• A61K 9/51 - Nanocapsules

Abrégé

The present disclosure provides to systems, methods, and compositions for template-based DNA, synthesis. Particularly the present disclosure provides systems, methods, and compositions for generating multi-site (e.g., three or more) sequence variants of template nucleic acid strands kilobases (e.g., greater than Ikb) m length.

Classes IPC  ?

• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN
• C07K 14/005 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant de virus
• C12N 15/86 - Vecteurs viraux

Abrégé

An insulated heating-unit cover having an opening to permit air to circulate around the heating-source when a vent disposed at the top of the cover is opened, allowing heat into a space. The cover can include a heating-unit temperature sensor disposed within a space covered by the cover and a controller in wireless communication with a space temperature sensor located at a distance away from the heating-unit. The controller can be configured to operate an actuator such that the vent is open when the space temperature sensor indicates that the ambient temperature is below a set point temperature and such that the vent is closed when the ambient temperature is greater than the set point temperature. The controller can communicate with a plurality of other similar controllers and a central server to effect changes in the output of a central heating source coupled to a plurality of individual heating-units.

Classes IPC  ?

• G09F 15/00 - Tableaux, panneaux, colonnes ou structures analogues pour des avis, des placards, des affiches ou des moyens d'information similaires
• F24D 19/00 - SYSTÈMES DE CHAUFFAGE DE LOCAUX DOMESTIQUES OU D'AUTRES LOCAUX, p. ex. SYSTÈMES DE CHAUFFAGE CENTRALSYSTÈMES D'ALIMENTATION EN EAU CHAUDE À USAGE DOMESTIQUELEURS ÉLÉMENTS OU PARTIES CONSTITUTIVES Détails
• F24D 19/06 - Enveloppes, couvercles de protection ou panneaux décoratifs pour radiateurs, p. ex. cache-radiateur
• F24D 19/10 - Aménagements ou montage des dispositifs de commande ou de sécurité
• F24F 11/30 - Aménagements de commande ou de sécurité en relation avec le fonctionnement du système, p. ex. pour la sécurité ou la surveillance
• F24F 11/38 - Diagnostic des défaillances
• F24F 11/46 - Amélioration de l’efficacité électrique ou économie d’énergie électrique
• F24F 11/52 - Aménagements pour l’indication, p. ex. écrans
• F24F 11/58 - Commande à distance par internet
• F24F 11/63 - Traitement électronique
• F24F 11/77 - Systèmes de commande caractérisés par leurs grandeurs de sortieDétails de construction de tels systèmes pour la commande de l’apport en air traité, p. ex. commande de la pression pour la commande du débit d'air ou de la vitesse de l’air en commandant la vitesse de rotation des ventilateurs
• F24F 110/10 - Température
• F24F 130/00 - Entrées de commandes relatives aux facteurs environnementaux non couvertes par
• F24F 130/10 - Informations ou prévisions météorologiques
• G05D 23/19 - Commande de la température caractérisée par l'utilisation de moyens électriques
• G09F 7/14 - Caractéristiques structurelles des éléments portant ou formant les symboles
• G09F 7/18 - Moyens pour fixer des enseignes, des plaques, des panneaux ou des tableaux à une structure de support

Abrégé

The subject matter described here relates to an enhancer specific to a subset of cholinergic neurons, that can control gene expression in a highly neuron-specific manner, wherein the enhancer is compatible with AAVs packaging and can induce gene expression or knockdown in cholinergic neurons in both post-natal and adult subjects.

Classes IPC  ?

• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• C12N 15/86 - Vecteurs viraux

Abrégé

22322 in the reaction mixture is precipitated in carbonate minerals.

Classes IPC  ?

• C22B 23/00 - Obtention du nickel ou du cobalt
• C22B 3/06 - Extraction de composés métalliques par voie humide à partir de minerais ou de concentrés par lixiviation dans des solutions inorganiques acides
• C22B 7/00 - Mise en œuvre de matériaux autres que des minerais, p. ex. des rognures, pour produire des métaux non ferreux ou leurs composés

Abrégé

Disclosed are self-healing power converter systems and methods including a plurality of converter phase-legs and a control system. The plurality of converter phase-legs include a first converter phase-leg and a second converter phase-leg, each converter phase-leg including a plurality of power converter modules, each power converter module including power switching elements. The control system includes a central controller, a first local controller to control the first converter phase-leg, and a second local controller configured to control the second converter phase-leg. The control system detects a fault with a first power converter module of the plurality of power converter modules of the first phase-leg. In response to detecting the fault, the control system disables a second power converter module of the plurality of power converter modules of the second phase-leg, and continues to drive at least one power converter module of each of the first phase-leg and the second phase-leg.

Classes IPC  ?

• H02M 1/32 - Moyens pour protéger les convertisseurs autrement que par mise hors circuit automatique
• H02M 3/158 - Transformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant continu sans transformation intermédiaire en courant alternatif par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande utilisant uniquement des dispositifs à semi-conducteurs avec commande automatique de la tension ou du courant de sortie, p. ex. régulateurs à commutation comprenant plusieurs dispositifs à semi-conducteurs comme dispositifs de commande finale pour une charge unique
• H02H 7/10 - Circuits de protection de sécurité spécialement adaptés aux machines ou aux appareils électriques de types particuliers ou pour la protection sectionnelle de systèmes de câble ou de ligne, et effectuant une commutation automatique dans le cas d'un changement indésirable des conditions normales de travail pour convertisseursCircuits de protection de sécurité spécialement adaptés aux machines ou aux appareils électriques de types particuliers ou pour la protection sectionnelle de systèmes de câble ou de ligne, et effectuant une commutation automatique dans le cas d'un changement indésirable des conditions normales de travail pour redresseurs

Abrégé

Disclosed are scalable power converter systems and methods. The scalable power converter system includes one or more power converter phase-legs including a plurality of power converter modules connected in parallel, each power converter module including power switching elements. The scalable power converter system further includes a control system including: a central controller and a local model predictive controller for each phase-leg. The central controller generates a reference target for each local controller based on sensed characteristics. Each local model predictive controllers controls, based on the reference target and model predictive control, the plurality of power converter modules of the power converter phase-leg that corresponds to the local model predictive controller.

Classes IPC  ?

• H02M 7/66 - Transformation d'une puissance d'entrée en courant alternatif en une puissance de sortie en courant continuTransformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant alternatif avec possibilité de réversibilité
• H02M 7/68 - Transformation d'une puissance d'entrée en courant alternatif en une puissance de sortie en courant continuTransformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant alternatif avec possibilité de réversibilité par convertisseurs statiques
• H02M 7/72 - Transformation d'une puissance d'entrée en courant alternatif en une puissance de sortie en courant continuTransformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant alternatif avec possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande
• H02M 7/79 - Transformation d'une puissance d'entrée en courant alternatif en une puissance de sortie en courant continuTransformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant alternatif avec possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande
• H02M 7/797 - Transformation d'une puissance d'entrée en courant alternatif en une puissance de sortie en courant continuTransformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant alternatif avec possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande utilisant uniquement des dispositifs à semi-conducteurs
• H02M 7/81 - Transformation d'une puissance d'entrée en courant alternatif en une puissance de sortie en courant continuTransformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant alternatif avec possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande agencés pour la marche en parallèle
• H02M 7/219 - Transformation d'une puissance d'entrée en courant alternatif en une puissance de sortie en courant continu sans possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande utilisant uniquement des dispositifs à semi-conducteurs dans une configuration en pont
• H02M 7/23 - Transformation d'une puissance d'entrée en courant alternatif en une puissance de sortie en courant continu sans possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande utilisant uniquement des dispositifs à semi-conducteurs agencés pour la marche en parallèle
• H02M 7/493 - Transformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant alternatif sans possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande les convertisseurs statiques étant agencés pour le fonctionnement en parallèle
• H02M 7/521 - Transformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant alternatif sans possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type thyratron ou thyristor exigeant des moyens d'extinction utilisant uniquement des dispositifs à semi-conducteurs dans une configuration en pont
• H02M 7/523 - Transformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant alternatif sans possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type thyratron ou thyristor exigeant des moyens d'extinction utilisant uniquement des dispositifs à semi-conducteurs avec un circuit résonnant LC dans le circuit principal

Abrégé

The present disclosure relates to engineering bacteria and methods for promoting barrier function in skin and mucosal surfaces. In particular, the disclosure is related to engineering bacterium to produce a delta hemolysin (delta toxin) peptide and methods of using the engineered bacteria or the delta hemolysin peptide for improving or maintaining gut health, regulating glucose metabolism, maintaining intestinal integrity, decreasing inflammation, modulating wound healing and tissue regeneration, and treating or preventing a disease or disorder.

Classes IPC  ?

• A01N 63/20 - BactériesSubstances produites par des bactéries ou obtenues à partir de celles-ci
• A61K 39/085 - Staphylococcus
• A61P 3/08 - Médicaments pour le traitement des troubles du métabolisme de l'homéostase du glucose
• A61P 1/00 - Médicaments pour le traitement des troubles du tractus alimentaire ou de l'appareil digestif
• A61P 37/00 - Médicaments pour le traitement des troubles immunologiques ou allergiques
• C12N 1/20 - BactériesLeurs milieux de culture
• C12N 15/74 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes procaryotes autres que E. coli, p. ex. Lactobacillus, Micromonospora

Abrégé

Described herein is a method of activating one or more bestrophin paralogs, comprising contacting the bestrophin paralog with a composition comprising a small molecule activator of one or more bestrophin paralogs.

Classes IPC  ?

• A61K 31/197 - Acides carboxyliques, p. ex. acide valproïque ayant un groupe amino les groupes amino et carboxyle étant liés à la même chaîne carbone acyclique, p. ex. acide gamma-aminobutyrique [GABA], bêta-alanine, acide epsilon-aminocaproïque ou acide pantothénique
• A61P 27/00 - Médicaments pour traiter les troubles des sens
• A61P 25/28 - Médicaments pour le traitement des troubles du système nerveux des troubles dégénératifs du système nerveux central, p. ex. agents nootropes, activateurs de la cognition, médicaments pour traiter la maladie d'Alzheimer ou d'autres formes de démence

Abrégé

Disclosed are interleaved power converter systems and methods including an interleaved power converter module and a control system. The converter module includes DC link nodes, a first transistor pair and a second transistor pair coupled between the DC link nodes, an LC filter circuit, and AC nodes. The control system includes a central controller and one or more local controllers. Each local controller receives a respective reference target from the central controller, generates a variable frequency soft switching (VFSS) control signal to drive the first transistor pair to output a first AC signal, and generates a phase-shifted VFSS control signal to drive the second transistor pair to output a second AC signal that is phase-shifted with respect to the first AC signal. The interleaved power converter module outputs, via the LC filter circuit, an interleaved signal comprising the first AC signal interleaved with the second AC signal.

Classes IPC  ?

• H02M 1/00 - Détails d'appareils pour transformation
• H02M 1/08 - Circuits spécialement adaptés à la production d'une tension de commande pour les dispositifs à semi-conducteurs incorporés dans des convertisseurs statiques
• H02M 3/15 - Transformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant continu sans transformation intermédiaire en courant alternatif par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande utilisant uniquement des tubes à décharge
• H02M 3/33 - Transformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant continu avec transformation intermédiaire en courant alternatif par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrodes de commande pour produire le courant alternatif intermédiaire utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande utilisant uniquement des tubes à décharge
• H02M 7/48 - Transformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant alternatif sans possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande

Abrégé

Orally-deliverable programmable bacteria cells that colonize colorectal tumors and produce diagnostic and therapeutic molecules, as well as related compositions and methods.

Classes IPC  ?

• A61K 35/741 - Probiotiques
• A61K 35/00 - Préparations médicinales contenant des substances ou leurs produits de réaction de constitution non déterminée
• A61P 35/00 - Agents anticancéreux
• C07K 14/535 - CSF du type granulocyteCSF du type granulocyte-macrophage
• C07K 16/28 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire
• C12N 15/70 - Vecteurs ou systèmes d'expression spécialement adaptés à E. coli
• G01N 33/53 - Tests immunologiquesTests faisant intervenir la formation de liaisons biospécifiquesMatériaux à cet effet
• G01N 33/574 - Tests immunologiquesTests faisant intervenir la formation de liaisons biospécifiquesMatériaux à cet effet pour le cancer

Abrégé

The present disclosure provides Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated transposon (CAST) systems and components thereof which are fully or partially derived from orthogonal CAST systems. More particularly, the present disclosure provides engineered CAST systems comprising one or more Cas proteins selected from: Cas5, Cas6, Cas7, Cas8, Cas12, and combinations thereof; and one or more transposon-associated proteins selected from TnsA, TnsB, TnsC, TnsD, TniQ, and combinations thereof, wherein at least one of TnsB, TnsC, or TniQ is a chimeric protein comprising amino acid sequences derived from respective TnsB, TnsC, or TniQ proteins, or homolog thereof, of at least two CAST systems.

Classes IPC  ?

• C12N 15/09 - Technologie d'ADN recombinant
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 15/63 - Introduction de matériel génétique étranger utilisant des vecteursVecteurs Utilisation d'hôtes pour ceux-ciRégulation de l'expression

Abrégé

The present disclosure provides engineered Cas8 proteins or a Cas8-Cas5 fusion proteins and systems thereof for use in methods for nucleic acid modification. Particularly, the present disclosure provides engineered Cas8 proteins or a Cas8-Cas5 fusion proteins and systems thereof which have one or more amino acid substitutions, additions, or deletions in the PAM-interacting region.

Classes IPC  ?

• C12N 9/22 - Ribonucléases
• C07K 14/315 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant de bactéries provenant de Streptococcus (G), p. ex. Enterocoques
• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN
• C12N 15/62 - Séquences d'ADN codant pour des protéines de fusion
• C12N 15/90 - Introduction stable d'ADN étranger dans le chromosome
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens

Abrégé

in vivoin vivo. Vaccination with the FFL induces neutralization titer higher than with live vaccine, providing robust humoral response, likely protective also for individuals with impaired cellular immunity. The 8 specific mAbs, alone or combined with mAb 77, neutralize post fusion transition of MeV fusion protein, interrupting the F refolding process and preventing conformational changes required for membrane fusion and viral entry: mAbs G3, F3, E11, 9E1D3, H8, 10H2G3, D9, and Y10F.

Classes IPC  ?

• A61K 39/165 - Virus des oreillons ou de la rougeole
• A61K 39/12 - Antigènes viraux
• C07K 14/005 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant de virus
• A61K 38/00 - Préparations médicinales contenant des peptides

Abrégé

The disclosure concerns oral formulations that enable delivery of therapeutic agents that are sensitive to stomach pH and/or have reduced ability to be absorbed. In one aspect, the oral formulation comprises: (a) phenyl boric acid (PBA)-functionalized chitosan grafted with branched polyethyleneimine (PEI) and (b) a therapeutic agent, wherein the therapeutic agent is encapsulated by the PB A- functionalized chitosan grafted with a branched PEI. In other aspects, the oral formulation comprises: (a) chitosan grafted with branched polyethyleneimine (PEI), (b) a therapeutic agent, wherein the therapeutic agent is encapsulated by the chitosan grafted with a branched PEI, and optionally (c) a eukaryotic cell membrane fragment. The disclosure also concerns methods of making and administering such oral formulations.

Classes IPC  ?

• A61P 3/04 - AnorexigènesMédicaments de l'obésité
• A61K 9/51 - Nanocapsules
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p. ex. composés antiphlogistiques et pour le cœur
• A61K 47/36 - PolysaccharidesLeurs dérivés, p. ex. gommes, amidon, alginate, dextrine, acide hyaluronique, chitosane, inuline, agar-agar ou pectine
• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN

Abrégé

Phonon engineered, lanthanide doped upconverting nanoparticles with very low phonon energies and tunable methods of synthesis that adjust OA:OM ratio and reaction temperature are provided. Low phonon energy KPb2X5 (X=Cl, Br) upconverting nanoparticles, both doped and undoped, exhibit dramatically suppressed multiphonon relaxation, enhancing upconversion emission from higher lanthanide excited states and enabling room temperature observation of avalanche like upconversion by Nd3+ ions. Intrinsic optical bistability (IOB) of the materials can provide bit level functionality to all optical computing. The IOB of Nd3+ doped nanocrystals, which are either bright or dark at the same excitation power based on power history, illustrate the functionality. High contrast switching and IOB are enabled via the photon avalanche process, which sustains population inversion between the ground and the first excited 4fN states of Nd3+ ions. The IOB of these nanocrystals can be controlled by temporal pump modulation and can store information.

Classes IPC  ?

• C09K 11/77 - Substances luminescentes, p. ex. électroluminescentes, chimiluminescentes contenant des substances inorganiques luminescentes contenant des métaux des terres rares
• C01F 17/36 - Composés contenant des métaux de terres rares et au moins un élément autre qu’un métal des terres rares, l'oxygène ou l'hydrogène, p. ex. La4S3Br6 le seul anion étant un halogénure, p. ex. NaYF4
• C01G 21/00 - Composés du plomb

Abrégé

Disclosed herein are lung progenitor cells that are in the form of lung organoids and methods of generating the lung progenitor cells. The lung organoids can be an important resource for treating lung disorders and injuries, studies in human lung regeneration, disease modeling, and drug target identification and validation.

Classes IPC  ?

• C12N 5/071 - Cellules ou tissus de vertébrés, p. ex. cellules humaines ou tissus humains
• A61K 35/42 - Appareil respiratoire, p. ex. poumons, bronches ou cellules pulmonaires
• C12N 5/00 - Cellules non différenciées humaines, animales ou végétales, p. ex. lignées cellulairesTissusLeur culture ou conservationMilieux de culture à cet effet
• G01N 33/50 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique

Abrégé

The present invention provides a compound having the structure wherein A is a ring structure, with or without substitution; X1 is C or N; X2 is N, O, or S; Y1 is H, -(alkyl), -(alkenyl), -(alkynyl), -(cycloalkyl), (haloalkyl), -(alkyl)-O-(alkyl) or -(alkyl)-(cycloalkyl); Y 2 is H, -(alkyl), -(alkenyl), -(alkynyl), -(cycloalkyl), (haloalkyl), -(alkyl)-O-(alkyl) or -(alkyl)-(cycloalkyl); Y3 is H-(alkyl), -(alkenyl), -(alkynyl), -(cycloalkyl), (haloalkyl), -(alkyl)-O-(alkyl) or -(alkyl)-(cycloalkyl); Y 4 is H-(alkyl), -(alkenyl), -(alkynyl), -(cycloalkyl), (haloalkyl), -(alkyl)-O-(alkyl) or -(alkyl)-(cycloalkyl); Y5 is H, -(alkyl), -(alkenyl), -(alkynyl), -(cycloalkyl), (haloalkyl), -(alkyl)-O-(alkyl) or -(alkyl)-(cycloalkyl); a and P are each present or absent and when present each is a bond.

Classes IPC  ?

• C07D 491/18 - Systèmes pontés
• A61K 9/00 - Préparations médicinales caractérisées par un aspect particulier
• A61K 9/70 - Bases pour bande, feuille ou filament
• A61K 31/485 - Dérivés du morphinane, p. ex. morphine, codéine
• A61K 47/38 - CelluloseSes dérivés
• A61P 25/04 - Analgésiques centraux, p. ex. opioïdes
• A61P 25/24 - Antidépresseurs
• C07D 471/18 - Systèmes pontés
• C07D 495/18 - Systèmes pontés

Abrégé

Exemplary apparatus and method can be provided for use with ultrasound imaging. The apparatus can include at least one implantable device which is configured to communicate with an ultrasound imaging system, be located by the ultrasound imaging system using ultrasound signals generated thereby to generate a location of the implantable device(s), and transmit data to the ultrasound imaging system from the location of the implantable device(s) that was located by the ultrasound imaging system. Further, it is possible to implant, into a structure, at least one device which is responsive to ultrasound signals generated by the ultrasound imaging system, locate the device(s) within the structure by the ultrasound imaging system using the ultrasound signals to generate a location of the device(s) within the structure, and transmit data to the ultrasound imaging system from the location of the device(s) that was located by the ultrasound imaging system.

Classes IPC  ?

• A61B 8/08 - Applications cliniques

Abrégé

Methods for intranasal delivery of a GLP-1 (glucagon-like peptide-1) drug, such as tirzepatide (TZP), using a formulation of the drug encapsulated in poly(lactic-co-glycolic acid) (PLGA) nanoparticles coated with chitosan (CS) and/or polyethylenimine-grafted chitosan (CSPEI) at an optimized condition for surface charge change and particle size control. The resulting formulation successfully provides dosing-dependent body fat loss in mice, showing a significant therapeutic effect.

Classes IPC  ?

• A61K 38/26 - Glucagons
• A61P 3/08 - Médicaments pour le traitement des troubles du métabolisme de l'homéostase du glucose
• A61P 3/10 - Médicaments pour le traitement des troubles du métabolisme de l'homéostase du glucose de l'hyperglycémie, p. ex. antidiabétiques
• A61P 3/04 - AnorexigènesMédicaments de l'obésité
• A61K 38/00 - Préparations médicinales contenant des peptides
• C07K 14/00 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés

Abrégé

A power conversion system and method for an electric vehicle includes a bidirectional power system including control circuitry that is electrically connected to interface circuitry and a power converter. The control circuitry is configured to: control, when the control circuitry detects an electrical connection between the interface circuitry and an external power network, a load to output a DC voltage from the load to the power converter; control, when the control circuitry determines that a mode command from a user control includes a traction mode instruction, the load to output the DC voltage from the load to the power converter; and control, when the load outputs the DC voltage, the power converter in a manner that causes the power converter to convert the DC voltage into an electric current.

Classes IPC  ?

• H02M 7/81 - Transformation d'une puissance d'entrée en courant alternatif en une puissance de sortie en courant continuTransformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant alternatif avec possibilité de réversibilité par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande agencés pour la marche en parallèle
• H02J 7/02 - Circuits pour la charge ou la dépolarisation des batteries ou pour alimenter des charges par des batteries pour la charge des batteries par réseaux à courant alternatif au moyen de convertisseurs
• H02P 27/08 - Dispositions ou procédés pour la commande de moteurs à courant alternatif caractérisés par le type de tension d'alimentation utilisant une tension d’alimentation à fréquence variable, p. ex. tension d’alimentation d’onduleurs ou de convertisseurs utilisant des convertisseurs de courant continu en courant alternatif ou des onduleurs avec modulation de largeur d'impulsions

Abrégé

The subject matter described here relates to anti-PD-1 monoclonal antibodies with increased size that are capable of modulating T-cell activity. In certain embodiments the monoclonal antibody comprises an additional Fc domain or CD22 domain.

Classes IPC  ?

• C07K 16/30 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire provenant de cellules de tumeurs
• A61K 40/33 - AnticorpsActivateurs de lymphocytes T

Abrégé

The present disclosure provides compositions and vectors comprising a transgene(s) encoding more than one isoform of Crumbs homologue-1 (CRB1) (e.g., CRB1-A and CRB1-B), and compositions thereof, for use in the treatment or prevention of CRB1-related diseases and disorder (e.g., autosomal recessive retinitis pigmentosa (RP) and Leber congenital amaurosis (LCA)).

Classes IPC  ?

• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61P 27/02 - Agents ophtalmiques
• C07K 14/47 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains provenant de vertébrés provenant de mammifères
• C12N 15/86 - Vecteurs viraux

Abrégé

Compositions for treating hematological conditions such as myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML) are provided. In particular, a population of CD8+ T lymphocytes with cytotoxic activity against leukemia cells is provided, as well as methods of isolating and enriching such cells for therapeutic applications.

Classes IPC  ?

• C12N 5/0783 - Cellules TCellules NKProgéniteurs de cellules T ou NK
• G01N 33/50 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique
• G01N 15/14 - Techniques de recherche optique, p. ex. cytométrie en flux
• C07K 14/705 - RécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire

Abrégé

Disclosed are systems, methods, and other implementations, including a method for configuring a machine learning (ML) system. The method includes determining for a layer, l, of the ML system sets of parameters defining one or more statistical distribution models (e.g., lognormal) used for directing the ML system to an optimized configuration. The layer is connected to one or more other layers through weighted connected, and includes configurable ML elements (e.g., neurons) that can be tuned. The method also includes adjusting one or more of, a) weights of the weighted connections of the layer according to parameters defining a first distribution model, b) adjustable parameters defining the first statistical distribution model, c) ML element parameters, defining operations of at least some of the configurable ML elements, according to parameters defining a second distribution model, and/or d) adjustable parameters defining the second distribution model.

Classes IPC  ?

• G06N 3/08 - Méthodes d'apprentissage

Abrégé

A platform for the detection of vertebrate-infecting viruses in a sample, the platform comprising a plurality of oligonucleotide probes, wherein, for each viral taxon included in the platform, the plurality comprises at least one probe partially or fully complementary to a portion of a predetermined coding sequence of said viral taxon, wherein the predetermined coding sequences of the viral taxa, or fragments thereof, cluster at about 60-100% sequence identity, wherein oligonucleotide probes partially or fully complementary to a portion of a predetermined coding sequence within a single viral taxon cluster at about 70-100% sequence identity, wherein each oligonucleotide probe is about 50-300 nucleotides in length, wherein different oligonucleotide probes of the plurality which bind the same predetermined coding sequence are tiled across said predetermined coding sequence at intervals of about 50-500 nucleotides, and wherein the plurality of oligonucleotide probes of the platform comprises 100,000 to 1,500,000 oligonucleotide probes.

Classes IPC  ?

• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN
• C12Q 1/70 - Procédés de mesure ou de test faisant intervenir des enzymes, des acides nucléiques ou des micro-organismesCompositions à cet effetProcédés pour préparer ces compositions faisant intervenir des virus ou des bactériophages
• C40B 40/06 - Bibliothèques comprenant des nucléotides ou des polynucléotides ou leurs dérivés
• G16B 25/30 - Conception de micromatrices

Abrégé

Biomarker: In our preclinical mouse models of AIHA and in patients with AIHA, we have identified a new T cell population that predicts onset of autoimmune hemolytic anemia. The cell phenotype is: CD4+CD39+CD73-CD25-FoxP3-. These cells secrete IL-17 and/or IFNy upon stimulation, suggesting that they perpetuate autoimmune pathology. Treatment: Failure of tolerance to RBCs leads to modulation of the purinergic signaling pathway. Using our preclinical mouse models of AIHA secondary to checkpoint inhibitors, we have observed that prophylactic/concurrent apyrase treatment mitigates disease onset.

Classes IPC  ?

• G01N 33/68 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique faisant intervenir des protéines, peptides ou amino-acides
• A61K 38/46 - Hydrolases (3)
• A61P 37/06 - Immunosuppresseurs, p. ex. médicaments pour le traitement du rejet de greffe
• C12N 9/16 - Hydrolases (3.) agissant sur les liaisons esters (3.1)
• C12Q 1/6883 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p. ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique

Abrégé

A surgical device, comprising: a handpiece, the handpiece comprising a touch sensor; a shaft extending from the handpiece and having a distal end; a surgical element disposed generally at the distal end of the shaft; and an actuator, the actuator being controllable by the touch sensor, and the actuator modulating movement of the surgical element. A surgical device, comprising: a handpiece; a surgical element; and a control train configured to control a movement of the surgical element in response to a user's touch on a touch sensor of the control train. A method, comprising: in response to a touch on a touch sensor of a surgical device, controlling any one or more of a direction of motion or a degree of motion of a surgical element of the surgical device.

Classes IPC  ?

• A61B 17/285 - Pinces chirurgicales combinées à des instruments coupants
• A61B 17/29 - Pinces pour la chirurgie faiblement invasive
• A61B 17/32 - Instruments chirurgicaux coupants
• A61B 17/00 - Instruments, dispositifs ou procédés chirurgicaux

Abrégé

A cathode active material having a polymer with helical perylene diimide (hPDI) subunits with the side-chains of the helical perylene diimide (hPDI) subunits removed and a method of manufacturing the cathode active material are provided. A rechargeable battery cell with the polymer as a cathode material, a magnesium metal anode, and an ether-based electrolyte.

Classes IPC  ?

• H01M 4/60 - Emploi de substances spécifiées comme matériaux actifs, masses actives, liquides actifs de composés organiques
• H01M 4/02 - Électrodes composées d'un ou comprenant un matériau actif
• H01M 4/38 - Emploi de substances spécifiées comme matériaux actifs, masses actives, liquides actifs d'éléments simples ou d'alliages
• H01M 10/0569 - Matériaux liquides caracterisés par les solvants

Abrégé

Disclosed are methods, systems, devices, and other implementations, including a voltage converter system that includes two or more Active Half Bridge (AHB) converter circuits, each of the two or more AHB converter circuits connected to one or more windings of a transformer, with each AHB converter circuit including one or more switches and one or more energy storage devices. The voltage converter system further includes one or more controllers to control electrical behavior of the two or more AHB converter circuits according to normalized switching functions representing the switching states of the switches of the two or more AHB converter circuits.

Classes IPC  ?

• H02M 3/335 - Transformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant continu avec transformation intermédiaire en courant alternatif par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrodes de commande pour produire le courant alternatif intermédiaire utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande utilisant uniquement des dispositifs à semi-conducteurs
• H02M 1/00 - Détails d'appareils pour transformation

Abrégé

The subject matter described here relates to methods of relocalizing proteins of the immune synapse to modulate T cell activation and the use of such methods to treat a disease in a subject in need thereof. Further described herein are anti-CD45 antibodies, in some embodiments with reduced affinity for CD45, as well as bispecific antibodies capable of modulating T-cell activity, wherein the two arms of the bispecific antibody are against CD45 and PD-1 or against CD43 and PD-1. In certain embodiments the bispecific antibody has reduced affinity for CD45 or CD43.

Classes IPC  ?

• C07K 16/28 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire
• C12N 15/62 - Séquences d'ADN codant pour des protéines de fusion
• C07K 14/715 - RécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire pour des cytokinesRécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire pour des lymphokinesRécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire pour des interférons
• A61P 35/00 - Agents anticancéreux

Abrégé

Compositions and methods for treating or preventing nonalcoholic steatohepatitis (NASH). In one aspect, the disclosed methods relate to targeting a macrophage receptor called cell immunoglobulin and mucin domain containing 4 (TIM4). The compositions and methods disclosed herein can be used as disease modifying therapies to enable treatment of NASH and related disorders earlier in disease progression and improve clinical outcomes.

Classes IPC  ?

• A61K 38/17 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains
• A61P 1/16 - Médicaments pour le traitement des troubles du tractus alimentaire ou de l'appareil digestif des troubles de la vésicule biliaire ou du foie, p. ex. protecteurs hépatiques, cholagogues, cholélitholytiques
• C07K 14/705 - RécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire
• C12N 15/864 - Vecteurs parvoviraux
• G01N 33/50 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique
• A61P 3/06 - Antihyperlipémiants

Abrégé

Provided herein are recombinant miniature swine without expression of endogenous porcine CD47 and SIRPA, but with the expression of human or humanized CD47 and human or humanized SIRPA under the same regulatory elements as the endogenous porcine CD47 and SIRPA. Also provided are cells, tissues, and organs derived from such recombinant miniature swine. Furthermore, provided herein are methods of transplanting a graft from a first donor of such recombinant miniature swine with or without bone marrow from a second donor of such recombinant miniature swine.

Classes IPC  ?

• A01K 67/0278 - Vertébrés knock-in, p. ex. vertébrés humanisés
• C07K 14/47 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains provenant de vertébrés provenant de mammifères
• C07K 14/705 - RécepteursAntigènes de surface cellulaireDéterminants de surface cellulaire
• C12N 15/85 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes eucaryotes pour cellules animales

Abrégé

Disclosed are systems, methods, and other implementations, including a method for battery performance analysis and management that includes measuring voltage response data for a lithium-ion battery in response to a bipolar current pulse signal applied to the lithium-ion battery, and determining, based on the measured voltage response data, using a bipolar pulse (BIP) model resultant battery characterization data representative of linear and nonlinear behavior of the lithium-ion battery. The resultant battery characterization data can include a set of multiple parameters of an equivalent circuit representation of the BIP model.

Classes IPC  ?

• G01R 31/367 - Logiciels à cet effet, p. ex. pour le test des batteries en utilisant une modélisation ou des tables de correspondance
• G01R 31/378 - Dispositions pour le test, la mesure ou la surveillance de l’état électrique d’accumulateurs ou de batteries, p. ex. de la capacité ou de l’état de charge spécialement adaptées à un type de batterie ou d’accumulateur
• G01R 31/3835 - Dispositions pour la surveillance de variables des batteries ou des accumulateurs, p. ex. état de charge ne faisant intervenir que des mesures de tension
• G01R 31/392 - Détermination du vieillissement ou de la dégradation de la batterie, p. ex. état de santé
• H01M 10/0525 - Batteries du type "rocking chair" ou "fauteuil à bascule", p. ex. batteries à insertion ou intercalation de lithium dans les deux électrodesBatteries à l'ion lithium
• H01M 10/42 - Procédés ou dispositions pour assurer le fonctionnement ou l'entretien des éléments secondaires ou des demi-éléments secondaires

Abrégé

PARP inhibitor (PARPi) resistance continues to undermine successful treatment of BRCA-mutant breast cancers in the clinic. Two immunocompetent, orthotopic models of Brca1- and Bard1-mutant breast cancer were generated to explore PARPi resistance mechanisms in vivo. In contrast to the expected DNA-repair-related resistance mechanisms, the models identified activation of FLT1 (VEGFR1) as the basis for PARPi resistance. PARPi-resistant breast tumors with increased expression of FLT1 have increased expression of the FLT1 ligand PIGF in the tumor microenvironment, which activates FLT1 and its downstream effector AKT. Genetic inhibition of Flt1 inhibits AKT activation and causes dramatic tumor regression of PARPi-resistant tumors, while axitinib, a pan-VEGFR antagonist, resensitizes PARPi-resistant breast tumors to PARP inhibition in vivo. It was also discovered that breast cancers expressing high levels of FLT1 before PARPi treatment show faster progression on PARPi. Thus, novel cancer therapeutic compositions and methods related to preventing or reversing PARPi resistance are described herein.

Classes IPC  ?

• A61K 38/46 - Hydrolases (3)
• A61P 35/00 - Agents anticancéreux
• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• C12N 9/22 - Ribonucléases
• G01N 33/50 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique
• A61K 31/416 - 1,2-Diazoles condensés avec des systèmes carbocycliques, p. ex. indazole

Abrégé

The present disclosure provides systems, methods, and compositions for prime-editing modification of c.828 splice site mutations in the peripherin-2 gene. Particularly the present disclosure provides systems, methods, and compositions for correcting one or more disease-causing splice site mutations selected from: c.828+3A>T, c.828+1G>A, c.828+2T>C, c.828+1G>T, and combinations thereof.

Classes IPC  ?

• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61K 38/17 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains
• A61P 27/02 - Agents ophtalmiques
• C12N 9/12 - Transférases (2.) transférant des groupes contenant du phosphore, p. ex. kinases (2.7)
• C12N 9/22 - Ribonucléases
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées

Abrégé

A modular bioreactor system is provided including a platform having a seat to receive a modular tissue chamber, and one or more platform interfacial members; and a releasable modular tissue chamber including a bottom surface, an open top, and sidewalls defining a well therein, the releasable modular tissue chamber configured to be received by the seat of the platform, the tissue chamber further including an interfacial member configured to releasably connect the modular tissue chamber to the platform, wherein a tissue chamber contains human bone marrow (engineered using iPS cell derived osteoblasts, osteoclasts, endothelial cells, supporting mesenchymal cells, and hematopoietic cells in bone matrix) infused by primary leukemia cells

Classes IPC  ?

• C12M 3/00 - Appareillage pour la culture de tissus, de cellules humaines, animales ou végétales, ou de virus
• C12M 1/12 - Appareillage pour l'enzymologie ou la microbiologie avec des moyens de stérilisation, filtration ou dialyse
• C12M 1/42 - Appareils pour le traitement de micro-organismes ou d'enzymes au moyen d'énergie électrique ou ondulatoire, p. ex. magnétisme, ondes sonores
• C12N 5/09 - Cellules tumorales

Abrégé

Disclosed are systems and methods for motor control using piecewise affine modelling. An electronic controller may determine current values for a motor in a rotational reference frame. Each current value may be associated with a dimension of a set of dimensions of the rotational reference frame. The electronic controller may further determine, based on the current values, a flux linkage value for each of the set of dimensions of the rotational reference frame using a piecewise affine map. The electronic controller may further determine a target flux linkage value for each of the set of dimensions of the rotational reference frame. The electronic controller may then control a power switching network coupled between a power supply and the motor based on the flux linkage values and the target flux linkage values.

Classes IPC  ?

• H02P 21/18 - Estimation de la position ou de la vitesse
• H02P 21/00 - Dispositions ou procédés pour la commande de machines électriques par commande par vecteur, p. ex. par commande de l’orientation du champ

Abrégé

Systems and methods of performing temperature swing solvent extraction (TSSE) descaling of produced water and desalination of high-salinity brines, e.g., those having a total dissolved solids (TDS) greater than about 250,000 ppm are capable of producing descaled water products including less than about 5% weight percent TDS. The brine/produced water feedstreams and combined with a solvent having temperature-dependent water solubility at a temperature TL. Water is extracted from the feedstream into the solvent to form a water-in-solvent extract component and a raffinate component, from which a solid phase can be precipitated as more water is portioned in the solvent and basicity increases. Heating of the water-in-solvent extract component reduces the solubility of the water therein, producing a biphasic mixture of dewatered solvent and descaled water that can be separated. Because these systems and methods do not require a phase change of water, these products are achieved with significantly higher energy efficiencies when compared to evaporation-based thermal methods.

Classes IPC  ?

• C02F 1/26 - Traitement de l'eau, des eaux résiduaires ou des eaux d'égout par extraction
• C02F 1/04 - Traitement de l'eau, des eaux résiduaires ou des eaux d'égout par chauffage par distillation ou évaporation
• C02F 1/44 - Traitement de l'eau, des eaux résiduaires ou des eaux d'égout par dialyse, osmose ou osmose inverse
• C02F 1/66 - Traitement de l'eau, des eaux résiduaires ou des eaux d'égout par neutralisationAjustage du pH
• C02F 103/08 - Eau de mer, p. ex. pour le dessalement
• C02F 103/10 - Nature de l'eau, des eaux résiduaires ou des eaux ou boues d'égout à traiter provenant de carrières ou d'activités minières

Abrégé

PAMAM-based nanocarriers with high loading efficiency of chemotherapeutics and high cfNA binding ability enable sustained delivery of chemotherapeutics while inhibiting systemic inflammation caused by the chemotherapy. This is useful for treating both primary and metastatic tumors with attenuated cognitive impairment.

Classes IPC  ?

• A61K 31/337 - Composés hétérocycliques ayant l'oxygène comme seul hétéro-atome d'un cycle, p. ex. fungichromine ayant des cycles à quatre chaînons, p. ex. taxol
• A61K 31/704 - Composés ayant des radicaux saccharide liés à des composés non-saccharide par des liaisons glycosidiques liés à un composé carbocyclique, p. ex. phloridzine liés à un système carbocyclique condensé, p. ex. sennosides, thiocolchicosides, escine, daunorubicine, digitoxine
• A61K 47/54 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p. ex. conjugués polymère-médicament l’ingrédient non actif étant un agent de modification l’agent de modification étant un composé organique
• A61K 47/69 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p. ex. conjugués polymère-médicament le conjugué étant caractérisé par sa forme physique ou sa forme galénique, p. ex. émulsion, particule, complexe d’inclusion, stent ou kit
• A61P 35/04 - Agents anticancéreux spécifiques pour le traitement des métastases

Abrégé

Methods of treating or preventing conditions in a subject are disclosed, the methods including administering to the subject a therapeutically effective amount of ethyl pyruvate, or a derivative or analog thereof, or a pharmaceutical composition thereof. Methods of treating or preventing conditions in a subject including administering to the subject a therapeutically effective amount of ethyl pyruvate, or a derivative or analog thereof, or a pharmaceutical composition thereof, and one or more additional therapeutic agents, are described.

Classes IPC  ?

• A61K 31/21 - Esters, p. ex. nitroglycérine, sélénocyanates
• A61K 31/215 - Esters, p. ex. nitroglycérine, sélénocyanates d'acides carboxyliques
• A61K 31/19 - Acides carboxyliques, p. ex. acide valproïque

Abrégé

Disclosed are implementations, including a method for medical/clinical monitoring that includes obtaining clinical and physiological measurement data for a patient, and contextual information associated with the patient and representative of location and time at which the clinical and physiological measurement data were obtained, and obtaining clinician behavior data for the clinicians while treating the patient. The method further includes determining intermittently, using an ensemble learning process, based on the measurement data and the contextual information, one of a plurality of medical state prediction models best suited for a current clinical situation associated with the patient. The method additionally includes determining, by the determined medical state prediction model, based on the measurement data and the clinician behavior data, prediction output data representing a medical and/or clinical state trajectory for the patient, and providing notification output data representative of the medical and/or clinical state trajectory for the patient.

Classes IPC  ?

• G16H 50/30 - TIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicalesTIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour le calcul des indices de santéTIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicalesTIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour l’évaluation des risques pour la santé d’une personne
• G16H 50/20 - TIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicalesTIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour le diagnostic assisté par ordinateur, p. ex. basé sur des systèmes experts médicaux
• G16H 50/70 - TIC spécialement adaptées au diagnostic médical, à la simulation médicale ou à l’extraction de données médicalesTIC spécialement adaptées à la détection, au suivi ou à la modélisation d’épidémies ou de pandémies pour extraire des données médicales, p. ex. pour analyser les cas antérieurs d’autres patients

Abrégé

Multi-target ligands, their synthesis, and their use in treating neurodegenerative diseases are provided.

Classes IPC  ?

• A61K 31/395 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines
• A61K 31/167 - Amides, p. ex. acides hydroxamiques ayant des cycles aromatiques, p. ex. colchicine, aténolol, progabide ayant l'atome d'azote d'un groupe carboxamide lié directement au cycle aromatique, p. ex. lidocaïne, paracétamol
• A61K 31/426 - 1,3-Thiazoles
• A61K 31/33 - Composés hétérocycliques

Abrégé

Provided herein are methods of regulating a subject's preference for fat and/or sugar and methods of screening a substance for an ability to activate a nutrient receptor in a subject's gut.

Classes IPC  ?

• A61K 31/5513 - 1,4-Benzodiazépines, p. ex. diazépam
• A61K 31/47 - QuinoléinesIsoquinoléines
• A61K 31/662 - Acides du phosphore ou leurs esters ayant des liaisons P-C, p. ex. foscarnet, trichlorfon
• A61K 38/22 - Hormones
• A61P 3/02 - Nutriments, p. ex. vitamines, minéraux

Abrégé

Compounds for, and methods of, modeling and treating a neurodegenerative disease, including without limitation frontal temporal dementia (FTD), are provided. An effective dose of a pharmaceutical composition is administered to a patient in need thereof, where the pharmaceutical composition targets at least one muscleblind-like protein (MBNL) binding site on exon 10 of microtubule-associated protein tau (MAPT) to block MBNL binding thereto. The at least one MBNL binding site may be 2 binding sites. The pharmaceutical composition may include the nuclease-inactive dCas13d in complex, with one or more guide RNAs, and/or antisense oligonucleotides (ASOs).

Classes IPC  ?

• C12N 15/113 - Acides nucléiques non codants modulant l'expression des gènes, p. ex. oligonucléotides anti-sens
• A61P 25/28 - Médicaments pour le traitement des troubles du système nerveux des troubles dégénératifs du système nerveux central, p. ex. agents nootropes, activateurs de la cognition, médicaments pour traiter la maladie d'Alzheimer ou d'autres formes de démence
• C12N 9/22 - Ribonucléases
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées

Abrégé

Disrupting convergence of lytic granules produced by cytotoxic lymphocytes allows non-directional degranulation, which improves and broadens killing efficiency of the cytotoxic cells in pathogenic environments such as when used for cancer therapy. Accordingly, methods of inducing multidirectional degranulation by cytotoxic effector cells in a tumor microenvironment, methods of treating a tumor, and related therapeutic composition are described.

Classes IPC  ?

• A61K 39/00 - Préparations médicinales contenant des antigènes ou des anticorps
• C12N 5/0783 - Cellules TCellules NKProgéniteurs de cellules T ou NK
• C12N 9/22 - Ribonucléases
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 15/90 - Introduction stable d'ADN étranger dans le chromosome

Abrégé

The present disclosure provides methods for the generation and purification of proteins and peptides comprising at least one 2-aminoisobutyric acid (Aib) and/or at least one masked form of Aib. The present disclosure further provides masked forms of Aib (e.g., of Formulas I-XVIII) and compositions and cell culture media that include such masked forms of Aib. The present disclosure further provides kits and/or systems for performing the methods described herein.

Classes IPC  ?

• C07C 323/58 - Thiols, sulfures, hydropolysulfures ou polysulfures substitués par des halogènes, des atomes d'oxygène ou d'azote ou par des atomes de soufre ne faisant pas partie de groupes thio contenant des groupes thio et des groupes carboxyle liés au même squelette carboné ayant les atomes de soufre des groupes thio liés à des atomes de carbone acycliques du squelette carboné le squelette carboné étant substitué de plus par des atomes d'azote, ne faisant pas partie de groupes nitro ou nitroso avec des groupes amino liés au squelette carboné
• C12N 5/10 - Cellules modifiées par l'introduction de matériel génétique étranger, p. ex. cellules transformées par des virus
• C07C 319/02 - Préparation de thiols, de sulfures, d'hydropolysulfures ou de polysulfures de thiols
• C12P 11/00 - Préparation de composés organiques contenant du soufre

Abrégé

Disclosed are systems, methods, computer program products, and other implementations, including a method for signal detection is disclosed that includes obtaining samples of observation data comprising a signal component produced by a source object, and a noise component, and generating based on at least one of the samples of the observation data, processed by a machine learning template derivation system, a filtering template to separate the signal component from the noise component, with the machine learning template derivation system including one or more trainable layers, and with at least one layer of the one or more trainable layers implementing a respective one of one or more iterations of an unrolled optimization process to determine optimized template parameters for the filtering template. The method further includes applying the filtering template to one or more of the samples of the observation data to obtain the signal component of the observation data.

Classes IPC  ?

• G06N 3/084 - Rétropropagation, p. ex. suivant l’algorithme du gradient

Abrégé

The subject matter discloses a metasurface hologram system, including at least a vacuum chamber, where an atomic array is configured to be trapped with various geometries, at least a laser generator, configured to generate one or more incident laser beams, and at least a metasurface hologram, configured to generate trap arrays.

Classes IPC  ?

• G02B 1/00 - Éléments optiques caractérisés par la substance dont ils sont faitsRevêtements optiques pour éléments optiques
• G21K 1/00 - Dispositions pour manipuler des particules ou des rayonnements ionisants, p. ex. pour focaliser ou pour modérer

Abrégé

A 3D printed structure is provided. The structure includes a composition formed from a mixture including an earth component, e.g., naturally occurring soil, subsoil, topsoil, clay, a clay-rich soil, sand, silt, an engineered soil formed of sand and clay, etc.; at least one fiber component, e.g., a bast or leaf fiber, including straw, wheat straw, rice straw, rice husk, reed, hay, hemp, kenaf, banana, sisal, fique, flax, jute, etc.; fluid component, e.g., water, oil, acid, etc.; and at least one additive component, e.g., a bio-based additive such as cellulose, a polypeptide such as gelatin, a polysaccharide such as alginate, guar gum, locust bean gum, chitosan, and xanthan gum, and lime, etc. The mixture includes a weight ratio of about 2-50 parts earth; about 5-50 parts fiber; about 25-80 parts fluid; and about 0-10 parts additive. The mixture can be 3D printed into prefabricated building elements, e.g., block-like geometries, monolithic walls, panels, etc.

Classes IPC  ?

• E04C 2/04 - Éléments de construction de relativement faible épaisseur pour la construction de parties de bâtiments, p. ex. matériaux en feuilles, dalles ou panneaux caractérisés par des matériaux spécifiés en béton ou autre matériau analogue à la pierre en ciment d'amiante
• B28B 1/00 - Fabrication d'objets façonnés à partir du matériau
• B33Y 10/00 - Procédés de fabrication additive
• B33Y 70/10 - Composites de différents types de matériaux, p. ex. mélanges de céramiques et de polymères ou mélanges de métaux et de biomatériaux
• B33Y 80/00 - Produits obtenus par fabrication additive

Abrégé

A method of modifying a nucleotide in a kinase gene on a double-stranded DNA molecule in a mammalian cell, the method comprising introducing to the cell a composition comprising a guide RNA molecule comprising a spacer sequence portion and a fusion protein comprising a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) nuclease and a base editing enzyme.

Classes IPC  ?

• C12N 15/90 - Introduction stable d'ADN étranger dans le chromosome
• C12N 9/22 - Ribonucléases
• C12N 9/78 - Hydrolases (3.) agissant sur les liaisons carbone-azote autres que les liaisons peptidiques (3.5)
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12Q 1/6876 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p. ex. amorces ou sondes

Abrégé

Mechanisms, including systems, methods, and media for establishing authenticity of image content are provided, the methods including: capturing an image using a camera; digitally signing the image using the camera to create a digital signature; and storing a first copy of the image in remote storage with the digital signature. In some embodiments, the image and the digital signature are stored in a blockchain. In some embodiments, the methods further comprise: retrieving a second copy of the image; and determining whether the second copy of the image is authentic based on the digital signature. In some embodiments, the methods further comprise generating an indicator that indicates to a person whether the second copy of the image is authentic. In some embodiments, the methods further comprise storing an indicator of edits made in the edited copy in the blockchain.

Classes IPC  ?

• H04L 9/32 - Dispositions pour les communications secrètes ou protégéesProtocoles réseaux de sécurité comprenant des moyens pour vérifier l'identité ou l'autorisation d'un utilisateur du système
• H04L 9/00 - Dispositions pour les communications secrètes ou protégéesProtocoles réseaux de sécurité

Abrégé

Transmembrane proteases are necessary for HPIV3 fusion protein cleavage in the human lung. HPIV3 fusion protein cleavage in the human lung is not furin dependent as previously thought, but instead is facilitated by transmembrane proteases, typically targeting TMPRSS2 expression. Serine protease inhibitors may be used in this manner to treat HPIV in a patient. Particular serine protease inhibitors shown to be effective include nafamostat, camostat, aprotinin, and leupeptin. Method of treating HPIV use serine protease inhibitors as treating agents.

Classes IPC  ?

• A61K 38/17 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'animauxPeptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant d'humains
• A61K 31/132 - Amines, p. ex. amantadine ayant plusieurs groupes amino, p. ex. spermidine, putrescine
• A61K 31/245 - Esters, p. ex. nitroglycérine, sélénocyanates d'acides carboxyliques ayant un noyau aromatique lié au groupe carboxyle ayant un groupe amino ou nitro du type acide aminobenzoïque, p. ex. procaïne, novocaïne
• A61P 31/16 - Antiviraux pour le traitement des virus ARN de la grippe ou des rhinovirus

Abrégé

The present disclosure provides methods of treating and preventing trigeminal nerve pain with modulators of oxidative stress (e.g., NRF2 transcription network activators and/or inhibitors of transient receptor potential ankyrin 1 (TRPA1)) and compositions thereof.

Classes IPC  ?

• A61K 33/24 - Métaux lourdsLeurs composés
• A61K 31/26 - Esters d'acide cyanique ou isocyaniqueEsters d'acide thiocyanique ou isothiocyanique
• A61K 31/522 - Purines, p. ex. adénine ayant des groupes oxo liés directement à l'hétérocycle, p. ex. hypoxanthine, guanine, acyclovir
• A61K 31/551 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à sept chaînons, p. ex. azélastine, pentylènetétrazole ayant deux atomes d'azote comme hétéro-atomes d'un cycle, p. ex. clozapine, dilazèpe
• A61K 31/5685 - Composés contenant des systèmes cycliques du cyclopenta[a]hydrophénanthrèneLeurs dérivés, p. ex. stéroïdes non substitués en position 17 bêta par un atome de carbone, p. ex. œstrane, œstradiol substitués en positions 10 et 13 par une chaîne ayant au moins un atome de carbone, p. ex. androstane, testostérone ayant un groupe oxo en position 17, p. ex. androstérone
• A61P 25/04 - Analgésiques centraux, p. ex. opioïdes

Abrégé

This disclosure is related to a method of sequencing a single-stranded DNA using deoxynucleotide polyphosphate analogues and translocation of tags from incorporated deoxynucleotide polyphosphate analogues through a nanopore.

Classes IPC  ?

• C12Q 1/6869 - Méthodes de séquençage
• C07H 19/10 - Radicaux pyrimidine avec le radical saccharide estérifié par des acides phosphoriques ou polyphosphoriques
• C07H 21/00 - Composés contenant au moins deux unités mononucléotide comportant chacune des groupes phosphate ou polyphosphate distincts liés aux radicaux saccharide des groupes nucléoside, p. ex. acides nucléiques
• G01N 33/487 - Analyse physique de matériau biologique de matériau biologique liquide

Abrégé

Media for making esophageal organoids, methods of making an esophageal organoid using that media, and esophageal organoids produced by those methods

Classes IPC  ?

• C12N 5/071 - Cellules ou tissus de vertébrés, p. ex. cellules humaines ou tissus humains
• C12N 5/09 - Cellules tumorales

Abrégé

Disclosed herein are vectors, synthetic antibodies, and methods of producing and using the same, comprising at least one polynucleotide sequence encoding an antibody or fragment thereof, wherein a variable heavy chain domain of the antibody or fragment thereof comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7, and a variable light chain domain of the antibody or fragment thereof comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.

Classes IPC  ?

• C07K 16/10 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant de virus de virus à ARN
• C12N 15/85 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes eucaryotes pour cellules animales
• A61K 39/42 - AnticorpsImmunoglobulinesImmunsérum, p. ex. sérum antilymphocitaire viraux
• A61P 31/16 - Antiviraux pour le traitement des virus ARN de la grippe ou des rhinovirus
• A61K 39/145 - Orthomyxoviridae, p. ex. virus de l'influenza

Abrégé

The present disclosure relates to compositions for increasing acetylated alpha-tubulin levels in peripheral neuronal cells. The present disclosure also relates to the use of tubulin deacetylase inhibitors, or activators of tubulin acetylation for increasing acetylated tubulin levels in the cells. The present disclosure also relates to methods for assessing risk of developing peripheral neuropathy by assessing the levels of acetylated alpha-tubulin. The present disclosure further relates to methods for treating a subject suffering from a peripheral neuropathy using the compositions described herein.

Classes IPC  ?

• A61K 31/437 - Composés hétérocycliques ayant l'azote comme hétéro-atome d'un cycle, p. ex. guanéthidine ou rifamycines ayant des cycles à six chaînons avec un azote comme seul hétéro-atome d'un cycle condensés en ortho ou en péri avec des systèmes hétérocycliques le système hétérocyclique contenant un cycle à cinq chaînons ayant l'azote comme hétéro-atome du cycle, p. ex. indolizine, bêta-carboline
• A61P 25/02 - Médicaments pour le traitement des troubles du système nerveux des neuropathies périphériques
• C12Q 1/6883 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p. ex. amorces ou sondes pour les maladies provoquées par des altérations du matériel génétique
• G01N 33/68 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique faisant intervenir des protéines, peptides ou amino-acides
• A61K 31/422 - Oxazoles non condensés et contenant d'autres hétérocycles

Abrégé

The present, disclosure relates to anti-SAA antibodies or fragments thereof, such as antibodies against human SAA1 or fragments thereof, that may be used in various therapeutic, prophylactic and diagnostic methods. The present antibodies or fragments thereof may be used to treat hematologic disorders such as acute myeloid leukemia, acute lymphoid leukemia, and myelodysplastic syndrome.

Classes IPC  ?

• C07K 16/28 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire
• C07K 16/00 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux
• A61K 39/395 - AnticorpsImmunoglobulinesImmunsérum, p. ex. sérum antilymphocitaire

Abrégé

The subject matter described herein relates to a method of treating cancer in a subject in need thereof using a bispecific molecule recognizing two antigen markers of different tissue lineages on the surface of The First Cell.

Classes IPC  ?

• C07K 16/30 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire provenant de cellules de tumeurs
• A61K 47/68 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif l’ingrédient non actif étant chimiquement lié à l’ingrédient actif, p. ex. conjugués polymère-médicament l’ingrédient non actif étant un agent de modification l’agent de modification étant un anticorps, une immunoglobuline ou son fragment, p. ex. un fragment Fc
• C07K 16/28 - Immunoglobulines, p. ex. anticorps monoclonaux ou polyclonaux contre du matériel provenant d'animaux ou d'humains contre des récepteurs, des antigènes de surface cellulaire ou des déterminants de surface cellulaire
• G01N 33/574 - Tests immunologiquesTests faisant intervenir la formation de liaisons biospécifiquesMatériaux à cet effet pour le cancer

Abrégé

Treatments and methods for inhibiting late Na current use fibroblast growth factor homologous factor (FHF), an endogenous channel modulator, to inhibit late Na current with high potency. A minimal effector domain is engineered within FHF (the “FHF-inhibiting-X-region” (FixR)) as a peptide inhibitor of late Na current that may be delivered intracellularly, for example as a cell-penetrating peptide, or via viral or plasmid delivery. As a non-limiting example, human adenovirus type 5 may be genetically modified with the sequence 5′-ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAG TCCAACAGCGACCGAGTGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGAC GGGCGCTCC-3′ (SEQ ID NO: 1). As pathophysiological impact of late Na current extends beyond cardiac myocytes to other physiological settings, including neurons of the central and peripheral nervous system and skeletal muscle, these treatments and methods provide potential therapeutic avenues for a range of human ailments, including cardiac conditions, neurological/neuropsychiatric disorders, and skeletal muscle conditions. Neurological/neuropsychiatric disorders include, for example, epilepsy and autism spectrum disorders, pain-related diseases, and myotonia.

Classes IPC  ?

• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61K 38/18 - Facteurs de croissanceRégulateurs de croissance
• A61P 9/06 - Antiarythmiques
• C12N 15/86 - Vecteurs viraux

Abrégé

2223222222 desorption decreases the energy costs associated with direct air capture of carbon dioxide.

Classes IPC  ?

• B01D 53/62 - Oxydes de carbone

Abrégé

The method of treating obesity and targeting adipose tissue in a patient may use injection of a polycationic polymer, such as polyamidoamine (PAMAM) generation 3 (P-G3) or a PCL-g-PAMAM Denpol, that when delivered intraperitoneally, selectively targets visceral adiposity due to its high charge density. P-G3 treatment of obese mice inhibits visceral adiposity, increases energy expenditure, prevents obesity, and alleviates associated metabolic dysfunctions. The extracellular matrix of adipose tissue is enriched with glycosaminoglycans, the known biomacromolecules with the strongest negative charge. P-G3 uncouples adipocyte lipid synthesis and storage from adipocyte development, creating adipocytes with normal functions but that are deficient in hypertrophic growth. The visceral fat distribution of P-G3 is further enhanced by modifying P-G3 with cholesterol to form lipophilic nanoparticles, effective in treating obesity. This strategy provides a method to target visceral adiposity, and cationic nanomaterials useful for treating metabolic diseases or for delivery of additional treating agents.

Classes IPC  ?

• A61K 31/785 - Polymères contenant de l'azote
• A61K 45/06 - Mélanges d'ingrédients actifs sans caractérisation chimique, p. ex. composés antiphlogistiques et pour le cœur
• A61K 47/28 - Stéroïdes, p. ex. cholestérol, acides biliaires ou acide glycyrrhétinique
• A61P 3/04 - AnorexigènesMédicaments de l'obésité

Abrégé

Examples of syringe assemblies and sets of components are disclosed for transferring a fluid sample for testing. In some examples, the syringe assembly comprises a housing, a barrel, a plunger reciprocally moveable in the barrel, a narrow tube connected to the barrel, and a metering actuator configured to control movement of the plunger at least in a proximal direction relative to the barrel. The metering actuator is configured to draw a precise microvolume of the fluid sample into a fluid chamber within the syringe assembly. In some examples, while the fluid chamber holds the fluid sample, the distal tip of the narrow tube remains covered, for example inside the housing or a reaction container. The syringe assembly is configured to expel the fluid sample from the fluid chamber into the reaction container.

Classes IPC  ?

• B01L 3/02 - BurettesPipettes

Abrégé

Processes, compositions, and apparatus are disclosed. A first process includes providing a cyclopropenimine (CPI). A second process includes providing 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU). The first and second processes include reacting the CPI and DBU, respectively, with carbon dioxide (CO2) in the presence of a nucleophilic species (NuH) and releasing CO2 from products of the reactions by heating to a temperature below about 120° C. A process of direct air capture includes obtaining atmospheric CO2, reacting the CO2 with an organic base having an imine moiety to form a NuCO2− salt, and heating the NuCO2− salt to a temperature below about 120° C. A composition for low-temperature CO2 release includes a tris(amino)cyclopropenium (TAC+) ion and NuCO2−. An apparatus includes a component configured to provide a composition, including a CPI, for capturing CO2 and a component configured to release the CO2 by heating a to a temperature below 120° C.

Classes IPC  ?

• B01J 20/26 - Composés macromoléculaires synthétiques
• B01D 53/04 - Séparation de gaz ou de vapeursRécupération de vapeurs de solvants volatils dans les gazÉpuration chimique ou biologique des gaz résiduaires, p. ex. gaz d'échappement des moteurs à combustion, fumées, vapeurs, gaz de combustion ou aérosols par adsorption, p. ex. chromatographie préparatoire en phase gazeuse avec adsorbants fixes
• B01J 20/28 - Compositions absorbantes ou adsorbantes solides ou compositions facilitant la filtrationAbsorbants ou adsorbants pour la chromatographieProcédés pour leur préparation, régénération ou réactivation caractérisées par leur forme ou leurs propriétés physiques
• B01J 20/32 - Imprégnation ou revêtement

Abrégé

22; and an amount of acid disposed in the container.

Classes IPC  ?

• H01M 10/52 - Enlèvement des gaz situés à l'intérieur de l'élément secondaire, p. ex. par absorption
• C25B 1/30 - Peroxydes
• C22B 1/00 - Traitement préliminaire de minerais ou de débris ou déchets métalliques
• C22B 3/00 - Extraction de composés métalliques par voie humide à partir de minerais ou de concentrés
• C22B 26/12 - Obtention du lithium

Abrégé

Provided herein are compositions, methods, and systems for DNA modification. In particular, provided herein are compositions, and systems comprising TnpB-like nuclease-dead repressors (dTnpB/TldRs), dCas12f or dCas12f-like proteins, and/or a TnpB-transposase fusion proteins and methods using thereof.

Classes IPC  ?

• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 9/22 - Ribonucléases

Abrégé

Disclosed are methods of epigenetic mapping with low input capabilities that enable applications to human tissues. The method can also be incorporated with automated/semi-automated capabilities to enable the use epigenetic mapping in prospective clinical trials. The methods comprise shearing the isolated chromatin using focused ultrasonication technology, preferably at least twice, prior to immunoprecipitation of the sheared chromatin and isolation for subsequent DNA analysis.

Classes IPC  ?

• C12Q 1/6806 - Préparation d’acides nucléiques pour analyse, p. ex. pour test de réaction en chaîne par polymérase [PCR]

Abrégé

Compositions and methods for treating or preventing nonalcoholic steatohepatitis (NASH) fibrosis, also known as MASH. In one aspect, the disclosed methods relate to targeting a MBOAT7 risk variant, rs641738, in order to increase MBOAT7 expression and down-stream signaling or to silence TAZ. The compositions and methods disclosed herein can be used as disease modifying therapies to enable treatment of NASH fibrosis/MASH and related disorders earlier in disease progression and improve clinical outcomes.

Classes IPC  ?

• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• A61K 38/45 - Transférases (2)
• C12N 15/86 - Vecteurs viraux

Abrégé

Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Also disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using polynucleotides, polypeptides and/or agents which increase efficiency of the “fork reversion and repair” pathway and/or decrease detrimental outcomes such as fork collapse, translesion synthesis and/or gap formation. Disclosed herein are agents, compositions and methods for increasing the developmental potential of human preimplantation embryos. Disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo by activating kinases and/or their signaling pathway in an oocyte including but not limited to ATR, WEE1, and CHK1. Also disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using polynucleotides, polypeptides and/or agents which increase efficiency of the “fork reversion and repair” pathway and/or decrease detrimental outcomes such as fork collapse, translesion synthesis and/or gap formation. Lastly disclosed herein are methods of reducing or decreasing replication abnormalities and/or aneuploidies in an embryo as well as increasing genome stability and/or developmental potential of an embryo using one or more polynucleotides or polypeptides including but not limited to CHEK1, WEE1, ETAA1, ATRX, BLM, BRCA2, CHD4, DNA2 (DNA2L), EXO1, FANCC, FANCG, FBH1 (FBX018), HLTF (SMARCA3), MCM9, MSH6, POLD3, POLK, RAD51, RAD52, RAD54L, RB1, RECQL, REV3L, RIF1, RNF8, SETD1A, SHPRH, SMARCAL1, TDRD3, TOPBP1, TP53BP1, WRNIP1, XRCC2, WRN, BRCAI, ZRANB3, CDC6, CDT1, POLH, POLI, FANCD2, INO80, FANCB, ASH2L, FAM35A, XRCC3, BRIP1, and RNF168.

Classes IPC  ?

• C12N 5/073 - Cellules ou tissus embryonnairesCellules fœtales ou tissus fœtaux
• C12N 9/22 - Ribonucléases
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 15/90 - Introduction stable d'ADN étranger dans le chromosome