A high-performance object detection system using HDR images obtained from LDR cameras, which allows for the separation and recognition of detected objects in images under high illumination difference conditions (tunnels, sunrise or sunset, etc.) and prevents autonomous vehicles from causing undesired accidents is provided.
A mini slotted random access protocol with an age threshold is used only by terminals that exceed the threshold value in terms of age of information, and has different probabilities of transmission in each mini slot in the protocol, the user population is shaped such that the age of information is minimized.
Near-infrared (NIR) absorbing photosensitizers for imaging and treatment of cancer in a photodynamic therapy (PDT) are provided. Specifically, the NIR photosensitizers are mitochondria targeted and water-soluble, and used as a cytotoxic drug in a photodynamic therapy of the cancer. The NIR photosensitizers are activated with wavelengths of light, wherein the light penetrates through a body not just a skin. Hence the NIR photosensitizers aim to transform PDT from being a specialized treatment to a generally applicable one. PDT is almost completely non-invasive compared to current treatment methods.
A novel capacitive micromachined ultrasonic transducer (CMUT) array is provided and the CMUT array employs an additional electrically-addressable conductive shield that isolates each array element individually, hence the novel array is coined as Faraday Caged CMUT array. The state of this conductive shield corresponding to each array element can be set as floating for reduced parasitic and cross-coupling capacitance or grounded for reduced electrical crosstalk. Perpetual, reliable operation in floating state without the risk of catastrophic dielectric electric field breakdown event is enabled by the self-discharging mechanism through diamond emitters featuring high field emission efficiency and acting as lightning rods in a cavity. The lightning rod structure features a movable diamond membrane, which deflects towards the diamond emitter due to electrostatic force (acting as a charge-controlled capacitive device) closing the gap to facilitate the safe intermittent discharging.
The invention relates to new 1-bit quantization and detection methods in uplink massive multiple input multiple output (MIMO) systems equipped with 1-bit analog-to-digital converters (ADCs).
H04B 7/06 - Diversity systemsMulti-antenna systems, i.e. transmission or reception using multiple antennas using two or more spaced independent antennas at the transmitting station
6.
QUANTIZATION AND DETECTION METHOD FOR 1- BIT ANALOG-TO- DIGITAL CONVERTERS
The invention is related to new quantization and detection methods for uplink massive multiple-input multiple-output (MIMO) - Orthogonal Frequency Division Multiplexing (OFDM) systems equipped with a 1-bit analog-to-digital converters (ADCs).
The invention is related with 2D passivation layer providing radical impact of electronic and steric effects on performance of 3D/2D perovskite solar cells.
H04L 9/32 - Arrangements for secret or secure communicationsNetwork security protocols including means for verifying the identity or authority of a user of the system
A compact holographic SLM spectrometer without an optical diffraction element is provided. The compact holographic SLM spectrometer performs the basic spectrometer function using a spatial light modulator (SLM). The compact holographic SLM spectrometer includes a light source, an input element, a collimator, an SLM, an analysis and detection optics, at least one detector, and a digital and/or analog control device.
A powering system for constant current neural stimulators provides adaptive supply voltage for neural stimulators to decrease power dissipation by taking advantage of varying voltage compliance of constant current stimulation. The powering system includes an adaptive voltage supply generator, a monitoring circuit, a charge pump, a step-down converter, and a rechargeable battery.
H02M 3/155 - Conversion of DC power input into DC power output without intermediate conversion into AC by static converters using discharge tubes with control electrode or semiconductor devices with control electrode using devices of a triode or transistor type requiring continuous application of a control signal using semiconductor devices only
13.
SMALL MOLECULES THAT ACTIVATE THE PROTEIN P-ARRESTIN2 INDEPENDENTLY OF RECEPTOR PHOSPHORYLATION
KARADENİZ TEKNİK UNİVERSİTESİ TEKNOLOJİ TRANSFERİ UYGULAMA VE ARASTİRMA MERKEZİ (Turkey)
ORTA DOĞU TEKNİK ÜNİVERSİTESİ (Turkey)
Inventor
Uzun Duran, Selcen
Demi̇rköz, Melahat Bilge
Alver, Ümit
Abstract
In particular, the invention relates to absorber material that reduces the harmful effects of neutron beams and gamma rays by absorbing neutron beams and secondary gamma and alpha rays generated by the absorption of neutron beams.
YILDIRIM BEYAZIT UNIVERSITESI MUHENDISLIK VE DOGA BILIMLERI FAKULTESI DEKANLIGI (Turkey)
ORTA DOGU TEKNIK UNIVERSITESI (Turkey)
Inventor
Unlu, Mehmet
Sahin, Asaf Behzat
Unutmaz, Muhammed Abdullah
Dal, Husnu
Kemiksiz, Tugba
Ozsahin, Gulay
Abstract
A phase shifter circuit (1), which creates a delay in a signal by changing the phase of the said signal, essentially comprising at least one base (2); at least one main line (3) made of a conductive material positioned on or within the base (2) and having an input end (4) and an output end (5) for signal input and output; a plurality of gaps (6) for trapping the signal transmitted over the main line (3); a plurality of conductive parts (8) positioned spaced apart from each other by a certain aperture, switching elements (9), which are located between each conductive part (8) and the main line (3), and control the electrical contact of the conductive parts (8) with the main line (3), and at least one control unit (10) adapted to control the switching elements (9) so as to create a delay in the said signal by trapping the said signal in the apertures between the conductive parts (8).
ASELSAN ELEKTRONIK SANAYI VE TICARET ANONIM SIRKETI (Turkey)
IHSAN DOGRAMACI BILKENT UNIVERSITESI (Turkey)
ORTA DOGU TEKNIK UNIVERSITESI (Turkey)
Inventor
Saygan, Samet
Akkus, Yigit
Cetin, Barbaros
Dursunkaya, Zafer
Abstract
A method for performance determination of a heat pipe with an arbitrary liquid flow area and prescribed geometric dimensions, an external and internal structure, a heat pipe material and a working fluid, heating and cooling surface areas, and condenser cooling conditions is provided to obtain operating and performance parameters, wherein the operating and performance parameters are temperature distribution within the heat pipe, a heat transferred via a phase change and a conduction, an axial variation of a radius of curvature of a liquid-vapor interface along the heat pipe, a vapor temperature and pressure of the working fluid, by simulating a flow and an energy transfer inside.
A high-resolution optical spectrometer with multiple diffractive optical elements operates under broadband light and enables spectral splitting with 3D diffractive optical elements. Diffractive optical elements are used to provide concentration of light as well as spectral splitting. Depending on the application, the high-resolution optical spectrometer operates with a reflection or transmission diffractive optical element. The number of operating wavelengths, spectral resolution, and operating bandwidth of diffractive optical elements are flexible depending on application.
G02B 23/06 - Telescopes, e.g. binocularsPeriscopesInstruments for viewing the inside of hollow bodiesViewfindersOptical aiming or sighting devices involving prisms or mirrors having a focusing action, e.g. parabolic mirror
19.
MODAL SUPERPOSITION METHOD USING RESPONSE DEPENDENT NON-LINEAR MODES FOR THE PERIODIC VIBRATION ANALYSIS OF LARGE NON-LINEAR STRUCTURES
A modal superposition method using a response dependent non-linear mode concept for a vibration analysis of non-linear engineering structures is provided. The modal superposition method is provided to find steady state response of non-linear systems in frequency domain. The modal superposition method is used in many mechanical structures, especially in design of aerospace and automotive structures, defense industry platforms, steam and gas turbines and mechanical structures containing non-linear forces such as gas turbine engines and jet engines.
H04L 9/32 - Arrangements for secret or secure communicationsNetwork security protocols including means for verifying the identity or authority of a user of the system
21.
DOPPLER SHIFT BASED DISTRIBUTED DRONE DETECTION SYSTEM
The present invention is intended to perform rotary wing drone (UAV) detection in the urban environment with low-power, low-cost radar systems. The system proposed in the invention, rotary wing drones (UAVs) perform classification before detection and positioning. Therefore, a large number of moving targets such as urban environments are filtered before detection.
G01S 7/41 - Details of systems according to groups , , of systems according to group using analysis of echo signal for target characterisationTarget signatureTarget cross-section
22.
A HIGH-PERFORMANCE OBJECT DETECTION SYSTEM USING HDR IMAGES OBTAINED FROM LDR CAMERAS IN AUTONOMOUS VEHICLES
The present invention relates to a high-performance object detection system using HDR images obtained from LDR cameras, which allows for the separation and recognition of detected objects in images under high illumination difference conditions (tunnels, sunrise or sunset, etc.) and prevents autonomous vehicles from causing undesired accidents.
The invention relates to biocompatible micron-scale spherical or non-spherical materials that can selectively separate bacterial cells from blood and various other liquids, and the synthesis methods thereof.
A61K 47/00 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additivesTargeting or modifying agents chemically bound to the active ingredient
A61K 49/18 - Nuclear magnetic resonance [NMR] contrast preparationsMagnetic resonance imaging [MRI] contrast preparations characterised by a special physical form, e.g. emulsions, microcapsules, liposomes
24.
FAST PHASE MODULATION WITH DIGITAL MICROMIRROR DEVICE
The invention relates to a method for fast phase modulation comprising at least one diffractive optical element (DOE) and a Digital Micromirror Device (1) for controlling the spatial phase of light emitted from a light source (4). The invention is characterized in that it comprises at least one first optical element (9) through which light coming from the light source (4) passes, at least one transparent diffractive optical element (10), and/or reflective diffractive optical element (11) located before or after the Digital Micromirror Device (1) and providing phase modulation of the light passing through the optical elements (9), at least one second optical element (9.1), which is used to reduce the post-modulation light to the target region (13), at least one data acquisition and/or controller element (12) for controlling the light reaching the target region (13).
The present invention relates to a high-resolution, high signal-to-noise ratio and high-bandwidth spectrometer that uses a multimode scattering medium. The spectrometer idea proposed in the present invention is an inventive notion that is based on the property of multiple interference and that aims to use a multimode waveguide and/or a multimode scattering medium together with a method for shaping light by using SLM. A spatial light modulator (SLM) used either before or after the fiber enables focusing or increasing the amount of light that is received at the detector. The resolution of the spectrometer to be build is determined by means of measuring the extent of the change in the wavelength of the incident light that will result in disruption of the focus created in the detector. It is concluded that the achieved resolution is exceedingly high because of the fact that the focus to be obtained by means of SLMs is a sharp focus with high intensity and that the sharper said focus becomes, the dependency thereof on the change occurring in the wavelength will be more precise. Subsequently, the optimized phase patterns required for different wavelengths are written over the SLM, thereby ensuring that each wavelength is focused, or the amount of light is increased, meanwhile the SLM phase pattern that forms each focus is recorded, creating a calibration dataset. This dataset may also be created by employing a method that is based on artificial intelligence. For a light source with an unknown spectrum, the prerecorded optimized phase patterns are individually written over the SLM, and the intensity of light generated on the detector is measured. Thus, a spectrometer is built by means of obtaining the change of light intensity depending on the wavelength as the data that relates to which wavelength belongs to each one of the phase patterns on the SLM is already available. As the SLM used herein may be preprogrammed with respect to which wavelength of light is transmitted or reflected depending on the which pattern is written thereon, the programming may also be changed dynamically during the respective experiments according to the design of the spectrometer. For the case that the light source that is being used is incoherent, by adding a time modulator to the input section of the spectrometer assembly, the spectrometer that permits achieving a higher rate of diversity in light sources can be achieved.
The invention relates to an integrated acoustophoretic microfluidic device (EAMC) in which integrated two or more step operations to be applied to micro and/or biological particles can be performed in a single microfluidic system using the acoustophoresis method in at least two of these. The device that is the subject of the invention has a multi-layer structure, contains an insulating layer that will act as an acoustic insulator between the layers, and allows a microfluidic unit operating with a different acoustic frequency to be placed in each layer. Thus, an acoustofluidic device is presented that is both reasonable in size and allows multi-stage micro and/or biological particle manipulation.
The invention is related to a thorax impactor (1) which will represent the thorax area of the pedestrians' body and provide for the evaluation of pedestrian injuries caused by flat front vehicles in tests, comprising a rear bracket (8) representing the spine.
The invention relates to a LIDAR imaging system, that comprising at least one light source (100) which enables illumination of the target (150) to be imaged and which provides the illumination time information, developed to obtain high resolution depth information.
The invention relates to a LIDAR device that can scan with a single structure in both vertical and horizontal planes. The invention is characterized in that it comprises at least one light source (110) sending the beam to scan the scanned area (130), at least one multi-surface scanner (100) enabling the transmission of the incident beams (101) sent from the said light source (110) to the scanned area (130) and at least one reflective optical component (140) placed at different angles on each surface of the said multi-surface scanner (100), at least one detector component (111) enabling the detection of the reflected beams (102) from the scanned area (130) and calculating the flight time of the beam sent, at least one control unit (150) to control the said light source (110), the multi-surface scanner (100) and the detector component (111) and connected to them by at least one signal/data transmission line (151), at least one rotating system (120) to move the said multi-surface scanner (100) circularly to different points of the space, and at least one linear movement system (121) to move the said multi-surface scanner (100) to axially in a direction different from the rotational axis.
The invention relates to a fitting system for fully implantable middle ear implant which uses acoustic waves to tune cochlear implant device according to patient comfort.
A new method, Jacobian Element Method (JEM), is proposed for numerical or analytical calculation of the Jacobian matrix in the solution of nonlinear multi-degree of freedom (MDOF) systems.
An MEMS airborne ultrasonic transducer system operating on a thermoacoustic principle to determine brain haemorrhage, includes: an RF transmitter and ultrasound receiver systems to transmit RF energy and receive ultrasound wave, respectively, an RF transmitter system having an RF signal generator, an RF amplifier and a horn antenna, and an ultrasound receiver system having a lock-in amplifier, a DC supply and two ultrasonic transducer arrays wirebonded to low noise amplifier (LNA) chips. The MEMS airborne ultrasonic transducer system determines brain haemorrhage based on detecting RF-induced, blood-originating, thermoacoustic ultrasound wave at the pulse modulation frequency.
This invention introduces a novel capacitive micromachined ultrasonic transducer (CMUT) array employing an additional electrically-addressable conductive shield that isolates each array element individually, hence the novel array is coined as Faraday Caged CMUT array. The state of this conductive shield corresponding to each array element can be set as floating for reduced parasitic and cross-coupling capacitance or grounded for reduced electrical crosstalk. Perpetual, reliable operation in floating state without the risk of catastrophic dielectric electric field breakdown event is enabled by the self-discharging mechanism through diamond emitters featuring high field emission efficiency and acting as lightning rods in a cavity. The lightning rod structure features a movable diamond membrane, which deflects towards the diamond emitter due to electrostatic force (acting as a charge-controlled capacitive device) closing the gap to facilitate the safe intermittent discharging.
H01L 27/20 - Devices consisting of a plurality of semiconductor or other solid-state components formed in or on a common substrate including magnetostrictive components
36.
METHOD OF OBTAINING MEMBRANES AND OTHER FUNCTIONAL FILMS BY ALIGNED DEPOSITION OF NANOROD STRUCTURED MATERIALS ON POROUS SURFACES VIA CROSS FLOW
The invention relates to a method for obtaining membrane and other functional films by aligned deposition of nanorod structured materials on porous surfaces via cross flow.
A spherically steerable microphone array structure is provided. The spherically steerable microphone array structure uses pressure and acoustic particle velocity signals obtained from sensors positioned co-planarly on a circular arc. The spherically steerable microphone array structure allows a calculation of all spatial partial derivatives of a sound field up to a given order. The spatial partial derivatives are used to obtain a spherical harmonic decomposition of a recorded sound field. Spherical harmonic decomposition coefficients are used in a spherically direction-invariant acoustic mode beamforming.
H04R 1/40 - Arrangements for obtaining desired frequency or directional characteristics for obtaining desired directional characteristic only by combining a number of identical transducers
38.
COST-EFFECTIVE FIBER OPTIC PRESSURE AND STRAIN SENSOR SYSTEM USING 1550 NM CENTER WAVELENGTH LED LIGHT SOURCE WITH FLRDS TECHNIQUE AND APPLICATION METHOD RELATED TO THIS SYSTEM
This invention is related to a with low-cost new design of ultra-high sensitive fiber optic pressure and strain sensors with fiber loop ringdown spectroscopy technique, and its property; having a LED light source (1) with a central wavelength of 1550 nm., optical lens (2) assembly to send the light pulse with minimum optical loss, a collimator (3) that allows the light to travel on a specific direction without deviation, a fiber loop (5) allows high sensitive measurement due to travelling incoming light from the collimator (3) several round in the loop, couplers (4) provides the light beam separation into the fiber loop (5) in different ratios such as 99.9:0.1, 99:1 to 90:10, a power meter (8) provides measurement of the signal coming from the fiber loop (5) by power meter sensor (7), a power supply (10) provides the electrical supply of all electronic components in the system, and includes the computer (9) or tablet (11), which processes the measured values by means of software according to the graphical analysis method.
The invention relates to a single PDMS layered pumpless microfluidic system in which the continuity of the spermatogonial stem cell maintenance and their microenvironment in the testicle in vitro is ensured.
This invention is related to the synthesis, characterization and investigation of electrochemical performance of new metal-doped layered sodium (lithium, potassium) metal oxides containing nickel, iron and manganese used as cathode active material in sodium (lithium, potassium) ion batteries with a new method. The layered sodium metal oxides can be used as cathode active material in rechargeable batteries and supercapacitor electrodes.
A recycling method of polylactic acid in a single step by using supercritical or dense gas carbon dioxide is provided. The recycling method includes the steps of adjusting a temperature of a reactor to at least 120° C., and adjusting a pressure to values above or below a critical pressure of carbon dioxide, wherein the critical pressure is 73.8 bar.
The invention relates to which is related to a powering system for constant current neural stimulators that provides adaptive supply voltage for neural stimulators to decrease power dissipation by taking advantage of varying voltage compliance of constant current stimulation.
This invention relates to the very rapid detection of SARS-CoV-2 virus, which causes COVID-19 disease, from breath using fiber optic sensors to which ultra-high sensitivity fiber ring loop damping spectroscopy (FHDSS) technique is applied. The invention is based on the application of fiber ring loop damping spectroscopy fiber optic sensor and sensor for the diagnosis of SARS-COV-2 virus from breath by collecting human breaths with breath collection bags and transporting them to the laboratory environment, which includes a sensor device for spectroscopic measurement, or by transporting the portable FRLDS fiber optic sensor system to the patient environment. Method, and its feature is that it consists of the following process steps: Preparation of the aminosilane reagent solution using acetone and keeping the sensor head (6) in this solution (200), Amine sililated sensor head (6), attaching SARS-CoV-2 IgG antibody to its surface (300), is the testing of breath samples from COVID-19 patients by sending them to the FRLDS (400) system with the SARS-CoV-2 IgG antibody attached sensor head (6).
C12Q 1/00 - Measuring or testing processes involving enzymes, nucleic acids or microorganismsCompositions thereforProcesses of preparing such compositions
C12Q 1/68 - Measuring or testing processes involving enzymes, nucleic acids or microorganismsCompositions thereforProcesses of preparing such compositions involving nucleic acids
C12Q 1/6876 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
G01N 21/00 - Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
G01N 33/569 - ImmunoassayBiospecific binding assayMaterials therefor for microorganisms, e.g. protozoa, bacteria, viruses
44.
A SILICON-BASED CLOSED AND INTEGRATED PLATFORM FOR THE INVESTIGATION OF RADIATION TRANSFER AT MICRO-NANO SCALE
The invention is a closed and integrated NFR platform (12) for inspection of radiation transfer at micro-nano scale, and comprises of an emitter (5) comprises of a silicon carbide thin film (2) coated on a silicon substrate (1), a receiver (6) comprising a silicon carbide thin film (2) coated on a silicon substrate (1). The silicon carbide thin films (2) of the emitter (5) and the receiver (6) are coated and bonded under vacuum along their patterned contact surfaces, silicon dioxide intermediate pillars such that distance between the emitter (5) and the receiver (6) is smaller than thermal radiation wavelength and parallel to each other. The attained integrated structure (7) at wafer size is diced to obtain 3cmx3cm chips. The fabrication method of the NFR platform (12) is within the scope of the invention.
The invention relates to a compact holographic SLM spectrometer without an optical diffraction element. The invention performs the basic spectrometer function using a spatial light modulator (SLM).
G03H 1/02 - Holographic processes or apparatus using light, infrared, or ultraviolet waves for obtaining holograms or for obtaining an image from themDetails peculiar thereto Details
G03H 1/22 - Processes or apparatus for obtaining an optical image from holograms
46.
LIME-POZZOLAN MORTARS WITH BIO-AGGREGATE FOR SOUND ABSORPTION AND THERM AT, INSULATION PURPOSES
22) as binder, pozzolanic additive, and wheat straw as a bio-aggregate, that provides sound and thermal insulation. Multi-layered and multifunctional plaster systems or insulation board systems are produced according to the purpose, with mortars having different "bindenpozzolanic additive:bio- aggregate" ratios.
C04B 28/14 - Compositions of mortars, concrete or artificial stone, containing inorganic binders or the reaction product of an inorganic and an organic binder, e.g. polycarboxylate cements containing calcium sulfate cements
C04B 28/02 - Compositions of mortars, concrete or artificial stone, containing inorganic binders or the reaction product of an inorganic and an organic binder, e.g. polycarboxylate cements containing hydraulic cements other than calcium sulfates
B23Q 11/00 - Accessories fitted to machine tools for keeping tools or parts of the machine in good working condition or for cooling workSafety devices specially combined with or arranged in, or specially adapted for use in connection with, machine tools
B23Q 17/12 - Arrangements for indicating or measuring on machine tools for indicating or measuring vibration
A fiber optic MEMS microphone featuring an electrically deflectable MEMS membrane via a conversion of an optical energy propagating in an optical fiber cable to an electrical energy with a photodiode chip. The fiber optic MEMS microphone includes a MEMS device, the photodiode chip, a voltage, a power adjustable laser beam and a light.
ASELSAN ELEKTRONİK SANAYİ VE TİCARET ANONİM ŞİRKETİ (Turkey)
İHSAN DOĞRAMACI BİLKENT ÜNİVERSİTESİ (Turkey)
ORTA DOĞU TEKNİK ÜNİVERSİTESİ (Turkey)
Inventor
Saygan, Samet
Akkuş, Yiğit
Çeti̇n, Barbaros
Dursunkaya, Zafer
Abstract
The invention relates to a method for performance determination of a heat pipe with arbitrary liquid flow area and prescribed geometric dimensions, external and internal structure, heat pipe material and working fluid, heating and cooling surface areas, condenser cooling conditions to obtain operating and performance parameters (temperature distribution within the heat pipe, the heat transferred via phase change and conduction, the axial variation of the radius of curvature of the liquid-vapor interface along the heat pipe, the vapor temperature and pressure of the working fluid) by simulating the flow and energy transfer inside.
F28D 15/02 - Heat-exchange apparatus with the intermediate heat-transfer medium in closed tubes passing into or through the conduit walls in which the medium condenses and evaporates, e.g. heat-pipes
50.
META TAG GENERATION METHOD FOR LEARNING FROM DIRTY TAGS
The present invention relates to a meta tag generation method that effectively trains deep learning-based systems on dirty data sets. New tags are produced for dirty data by using a limited number of known clean data. The system to be used for computer vision is trained by means of generated tags instead of dirty tags. In this way, reduction in performance caused by dirty tags will be prevented. Furthermore, the proposed method can be used on untagged data. It allows training on datasets consisting of a combination of clean-tagged, dirty-tagged and untagged data with this aspect.
The invention relates to a damping element consisting of viscoelastic material and designed for damping wind turbine vibrations and increasing fatigue life of the structure.
A semiconductor photodiode which functions in a wide band range up to medium wave infrared and far wavelengths in addition to visible region and near infrared includes: a light absorber region in micro structure which can provide light absorbance upon being roughened by laser; a first electrical lower contact coated with metal materials such as aluminium (Al), silver (Ag); a silicon which consists of crystalline silicon (c-Si); a second electrical lower contact which is coated with metal materials such as aluminium (Al), silver (Ag); a chalcogen doped hyper-filled silicone region which is obtained as a result of doping by pulse laser to the silicone region implanted by chalcogen elements; and upper electrical contact parts which are coated generally in the thickness range of 10 nm-1000 nm by using two-layered alloys with aluminium (Al)—(Al)-silver (Ag), two-layered alloys with titanium (Ti)-gold (Au), three-layered alloys with Ti-Platinum(Pt)—Au—Ag or three-layered alloys with Ti-lead(Pb)—Ag.
H01L 31/103 - Devices sensitive to infrared, visible or ultraviolet radiation characterised by only one potential barrier or surface barrier the potential barrier being of the PN homojunction type
H01L 31/0288 - Inorganic materials including, apart from doping material or other impurities, only elements of Group IV of the Periodic System characterised by the doping material
H01L 31/18 - Processes or apparatus specially adapted for the manufacture or treatment of these devices or of parts thereof
Pichia pastoris alcohol oxidase 1 (AOX1) promoter variants include at least one of the specified modifications on wild-type Pichia pastoris AOX1 promoter (SEQ ID NO: 1). The modifications include the following: a) integration of a Cat8 transcription factor binding site (TFBS), particularly integration of SEQ ID NO: 6 or SEQ ID NO: 7 or other gene sequences that show at least 80% similarity with these sequences, at any position within nucleotides 94 to 110, 141 to 160, 312 to 330, 355 to 380, 501 to 521; 640 to 658, 674 to 693, and 1 to 840; b) integration of Aca1 or Aca2 TFBS particularly integration of SEQ ID NO: 8 or other gene sequences showing at least 80% similarity with this sequence at any position between the nucleotides 1 to 840; c) mutations specified with SEQ ID NO: 2 within nucleotides 94 to 693 and combinations thereof.
The invention relates to a method of producing zeolite 3A and zeolite 5A directly, in which aluminasilicates such as sodium feldspar, halloysite, kaolin, pyrophyllite and/or natural zeolites are used, in addition to this, natural sources of calcite, which is a source of calcium, and potash, which is a source of potassium, are used respectively, without requiring any ion exchange process.
C01B 39/00 - Compounds having molecular sieve and base-exchange properties, e.g. crystalline zeolitesTheir preparationAfter-treatment, e.g. ion-exchange or dealumination
C01B 39/02 - Crystalline aluminosilicate zeolitesIsomorphous compounds thereofDirect preparation thereofPreparation thereof starting from a reaction mixture containing a crystalline zeolite of another type, or from preformed reactantsAfter-treatment thereof
56.
OPTICAL SPECTROMETER BASED ON ALTERNATING DIFFRACTIVE OPTICAL ELEMENTS
Measurement of both quantitative absolute concentrations and frequency-dependent cross-sectional areas of atoms and molecules by absorption, transmission, and reflection spectroscopy techniques, are of great importance for many fields, especially analytical and physical chemistry. Optical spectrometers are widely used initially in optical identification of materials, chemical analysis, security applications, astronomical discoveries, and biomedical diagnostics. The use of optical spectrometers is increasing with our scientific and technological advancement, and the need for portable optical spectrometers with higher performance, low weight, and small volume are important. Also, high accuracy spectrometers are needed for a trace amount of sample/analyte detection. This invention relates to a high-resolution optical spectrometer with multiple diffractive optical elements that can operate under broadband light. Unlike commonly used diffraction gratings, our invention enables spectral splitting with 3D diffractive optical elements. The diffractive optical elements used provide concentration of light as well as spectral splitting. Depending on the application, the system can work with a reflection or transmission diffractive optical element. Our invention makes it possible to vary the number of operating wavelengths, spectral resolution, and operating bandwidth of diffractive optical elements depending on application.
A method does not use high resource and high power consuming memory elements (LUT, Block RAM, etc.) or a distributed RAM in an implementation of nonlinear activation functions of artificial neural networks (ANN), eliminating a need for multiplication elements completely by using shift operations. Since each neuron includes an activation function, eliminating a multiplication element saves significant amount of resource and power in an implementation of the ANN.
G06F 5/01 - Methods or arrangements for data conversion without changing the order or content of the data handled for shifting, e.g. justifying, scaling, normalising
58.
GENETIC MOLECULE ENCAPSULATION IN MESOPOROUS SILICA/POLYETHYLENE GLYCOL HYBRID STRUCTURE
The present invention is an encapsulation method for transporting the genetic molecule in a preservative material, most generally, comprises the following process steps of adding alcohol to a silica source and polyethylene glycol source and mixing and obtaining two separate solutions, adding the polyethylene glycol solution to the silica solution, mixing and adding water to hydrolyze the solution, during condensation, just before gelling, in order to transport inside the pores of the amorphous structure formed, adding a genetic molecule in its buffer solution to the hydrolyzed solution or adding the hydrolyzed solution to a genetic molecule in its buffer solution and then obtaining a gel, obtaining a dry gel by drying/aging the gel and powdering the dry gel. Hybrid material of the mesoporous silica/polyethylene glycol and silica/polyethylene glycol/polyethyleneimine, carrying the genetic molecule inside, obtained by this method, is also covered by the scope of invention.
A61K 48/00 - Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseasesGene therapy
C12N 15/11 - DNA or RNA fragmentsModified forms thereof
C12N 15/88 - Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using liposome vesicle
C01B 33/18 - Preparation of finely divided silica neither in sol nor in gel formAfter-treatment thereof
The invention relates to a multi-purpose barrier-free access system which can easily be adjusted to different levels of heights in both indoors and outdoors with air, marine, land and railway transportation vehicles, and which can be used by all individuals, with or without disabilities.
A method for reducing a total operational load of a method of a model predictive control-by conducting simplifications based on specific observations, in order to drive alternating current motors by using the method of the MPC with a two-level voltage source inverter. The method includes the steps of determining at which one of the predefined sectors a resultant of stator currents is present, determining a motor mode, reducing seven estimation vectors to four estimation vectors and calculating a cost function or reducing seven estimation vectors to five estimation vectors and calculating the cost function.
H02P 21/00 - Arrangements or methods for the control of electric machines by vector control, e.g. by control of field orientation
H02P 21/14 - Estimation or adaptation of machine parameters, e.g. flux, current or voltage
H02P 27/06 - Arrangements or methods for the control of AC motors characterised by the kind of supply voltage using variable-frequency supply voltage, e.g. inverter or converter supply voltage using DC to AC converters or inverters
61.
Alcohol dehydrogenase 2 (ADH2) promoter variants by promoter engineering
Pichia pastoris ADH2 promoter (SEQ ID NO: 1). The modification includes one of the following mutations: integration of a Cat8 transcription factor binding site (TFBS), particularly integration of SEQ ID NO: 3 or other gene sequences that show at least 80% similarity with this sequence, at any positions within nucleotides a) 647 to 660; b) 739 to 752; c) 1 to 948; and d) mutations specified with SEQ ID NO: 2 within nucleotides 15 to 848 separately and combinations thereof.
A system to develop a light detection and range determination (LIDAR) application by a rotation of optical elements embedded on a rotating disk in a spherical geometry is provided. The system further enables to conduct a fastest possible spatial scanning mechanically and to determine flight times of light beams by adaptive elements according to a distance and a size of a target region.
A self-operating oscillator which increases an input DC voltage by a coefficient factor of 4 or more is provided. The self-operating oscillator includes a primary LC tank pair, a secondary LC tank pair, and a switch pair. The primary and the secondary LC tank provide a differential sinusoidal output voltage which corresponds to high amplitude, low phase noise and high purity.
H03B 5/12 - Generation of oscillations using amplifier with regenerative feedback from output to input with frequency-determining element comprising lumped inductance and capacitance active element in amplifier being semiconductor device
Near-infrared (NIR) absorbing photosensitizers for imaging and treatment of cancer in a photodynamic therapy (PDT) are provided. Specifically, the NIR photosensitizers are mitochondria targeted and water-soluble, and used as a cytotoxic drug in a photodynamic therapy of the cancer. The NIR photosensitizers are activated with wavelengths of light, wherein the light penetrates through a body not just a skin. Hence the NIR photosensitizers aim to transform PDT from being a specialized treatment to a generally applicable one. PDT is almost completely non-invasive compared to current treatment methods.
The invention is related to a Low-Stress Stereolithography comprising a mobile tank that has a tilted structure that can carry out mobile laser and oscillation motion.
TÜBİTAK TÜRKİYE BİLİMSEL VE TEKNOLOJİK ARAŞTIRMA KURUMU (Turkey)
Inventor
Özgüven, Hasan Nevzat
Karaağaçli, Taylan
Abstract
The invention is related to the field and methodologies of "nonlinear system identification in structural dynamics". In other words, it is related to the field and methodologies of constructing a mathematical model describing the vibration behaviour of a nonlinear system using experimental data. Moreover, the invention can also be used for systems in which nonlinear properties can be neglected.
In the present invention, an analog distortion generator generating a distortion signal to prevent intermodulation distortion that occurs when amplifying multitone signals is developed. The said analog distortion generator comprises at least one signal generator (O) generating at least one mixing signal (Vm); at least one first mixer (1) for mixing a multitone input signal (Vin) with the said mixing signal (Vm) to form an intermediate frequency signal (Vif); at least one second mixer (2) that enables the formation of an output signal (Vo) by mixing the intermediate frequency signal (Vif) generated by the first mixer (1) with said mixing signal (Vm).
ASELSAN ELEKTRONIK SANAYI VE TICARET ANONIM SIRKETI (Turkey)
ORTA DOGU TEKNIK UNIVERSITESI (Turkey)
Inventor
Coteli, Mert Burkay
Hacihabiboglu, Huseyin
Abstract
A method is provided for acoustic source direction of arrival estimation and acoustic source separation, via spatial weighting of the dictionary based display of the steered response function calculated for a certain number of directions from spherical harmonic decomposition coefficients obtained from microphone array recordings of the sound field. The usage of spatial band limited functions of plane waves to represent more complex directional maps of the sound field constitutes the algorithm. These functions are calculated for pre-defined directions on an analysis surface (such as a sphere). The directions of arrival of sound sources are calculated with the same method in order to group source estimates to localize sound sources. Thereby, directions of arrival can be obtained from the recordings of the sound sources captured by means of a microphone array and following this, sound sources can be separated by using this direction information or predetermined source arrival directions.
Chemiluminescence, or chemical luminescence, is the condition of a very small amount of thermal radiation and light radiation as a consequence of the chemical reaction that takes place in the substance. The luminol compound known in the literature is a chemiluminescent substance and is usually used in various applications. Luminol is an acyl-hydrazide ring and it contains the typical properties of this class. Its properties such as photo and thermal stability and chemical behavior in protic polar environments make this substance a good candidate in forensic science. When some important disadvantages of luminol (insolubility, low luminous quantum efficiency (1%) and misleading results in tests and/or disrupting the biologically active (DNA, etc.) structure in the sample being studied, etc.) are taken into consideration, new compounds that are designed so as to eliminate these disadvantages have great importance. It is required to use equally effective markers so as to make effective imaging, especially at the scene of a crime in forensic science. It is considered that this problem will be eliminated by means of these compounds. If the compounds designed in the same manner (different from luminol) only respond to iron ions, the fact about the images taken at the scene of a crime is based on blood samples will be obtained in a more evidential manner/with more clear evidence. After this study, the chemiluminescent radiation sensitivity of the compounds (especially for the detection of blood findings on the scene in forensic cases) to hemin and blood samples will be analyzed.
The invention, is related to environmentally friendly materials that have been formed by increasing the antimicrobial effectiveness, antimicrobial efficiency and thermal resistance thereof, by encapsulating thymol and other similar organic molecules that are antimicrobial essential oils, that are not limited with a pore size, and that have been given a hierarchical structure by expanding their microporosities, into zeotype materials having a silicate structure with a low Si/Al ratio varying between 1-3 or titanium chain.
A01N 25/08 - Biocides, pest repellants or attractants, or plant growth regulators, characterised by their forms, or by their non-active ingredients or by their methods of applicationSubstances for reducing the noxious effect of the active ingredients to organisms other than pests containing solids as carriers or diluents
A61L 2/235 - Solid substances, e.g. granules, powders, blocks, tablets cellular, porous or foamed
ASELSAN ELEKTRONİK SANAYİ VE TİCARET ANONİM ŞİRKETİ (Turkey)
ORTA DOĞU TEKNİK ÜNİVERSİTESİ (Turkey)
Inventor
Kiliçarslan, Yusuf
Dölen, Melik
Abstract
The invention in general is related to a magnetic modular fixture (fixation) system and a method thereof which enables processing/ manufacturing mechanical work pieces which comprises precise geometrical elements with a high accuracy. Said magnetic modular fixture (fixation) system and a method thereof enables processing/ manufacturing said parts by means of preventing thermal and mechanical stress on the work pieces with precise geometry.
B23K 37/04 - Auxiliary devices or processes, not specially adapted for a procedure covered by only one of the other main groups of this subclass for holding or positioning work
B25B 11/00 - Work holders or positioners not covered by groups , e.g. magnetic work holders, vacuum work holders
B23Q 37/00 - Metal-working machines, or constructional combinations thereof, built-up from units designed so that at least some of the units can form parts of different machines or combinationsUnits therefor in so far as the feature of interchangeability is important
F16M 13/00 - Other supports for positioning apparatus or articlesMeans for steadying hand-held apparatus or articles
72.
MEMS AIRBORNE ULTRASONIC TRANSDUCER SYSTEM FOR DETECTING BRAIN HAEMORRHAGE
The invention relates to MEMS airborne ultrasonic transducer system to determine brain haemorrhage based on detecting RF-induced, blood-originating, thermoacoustic ultrasound wave at the pulse modulation frequency.
The present invention relates to machine windings that are important components of electrical machines. The invention characterized in that it is cut from a thin electrically conductive sheet (1) and has at least one bending point such as the lower bending point (5), the middle bending point (6) and the upper bending point (7), and that the bending angles are at least 90° and not more than 180°. Another characterization of the invention is that more than one electrical machine windings (9) are connected with the end winding connectors (17) from the end windings (13), and an electrical insulating material (16) is placed between two adjacent electrical machine windings (9) to provide electrical insulation therebetween, thus obtaining the multiple electrical machine winding (14). While this winding method of the invention provides ease of production for electrical machine windings, it can also increase the efficiency with short end winding (13) and satisfy high current requirements.
H02K 15/04 - Processes or apparatus specially adapted for manufacturing, assembling, maintaining or repairing of dynamo-electric machines of windings prior to their mounting into the machines
The invention is related to a novel modal superposition method using the response dependent non-linear mode concept for vibration analysis of non-linear engineering structures.
A spherically steerable microphone array structure is disclosed which uses pressure and acoustic particle velocity signals obtained from sensors that are positioned co-planarly on a circular arc. The invention allows the calculation of all spatial partial derivatives of the sound field up to a given order. These spatial derivatives are used to obtain a spherical harmonic decomposition of the recorded sound field. The spherical harmonic decomposition coefficients are used in spherically direction-invariant acoustic mode beamforming.
H04R 1/40 - Arrangements for obtaining desired frequency or directional characteristics for obtaining desired directional characteristic only by combining a number of identical transducers
76.
A NEUTRON DETECTOR WITH SOLID-LIQUID MODERATORS FOR MEASURING NEUTRONS AT DIFFERENT ENERGY RANGES
The neutron detector that allows the measurement of neutrons under different energies enable the solid and liquid moderators with changeable thicknesses to be used in the same design. The detector is simply comprised of a cylindrical solid moderator movement chamber (1), a detector measurement chamber (2) and a liquid moderator storage chamber (3), which are stacked on each other. The detector measurement chamber (2) is formed of a detector (4) at the center and a tungsten sheath (9) providing a shield to the detector by surrounding it, against gamma radiation. The solid moderator motion lever (5) is fixed to the solid moderators (7) and hence enables them to move in the vertical axis.
222 nanodispersive solution from dolomite itself and the method of its application to strengthen the deteriorated dolomite stone (dolostone) by synthesizing dolomite within the weak parts of the stone.
C08J 11/00 - Recovery or working-up of waste materials
C08J 11/04 - Recovery or working-up of waste materials of polymers
C08J 11/16 - Recovery or working-up of waste materials of polymers by chemically breaking down the molecular chains of polymers or breaking of crosslinks, e.g. devulcanisation by treatment with inorganic material
B29B 17/00 - Recovery of plastics or other constituents of waste material containing plastics
The invention relates to fiber optic MEMS microphone that features electrically deflectable MEMS membrane via conversion of optical energy propagating in the optical fiber to electrical energy with photodiode chip.
The present invention generally relates to detection of concealed objects under the clothes of humans using passive MMW/THz imaging technique with variable focal length configuration.
ASELSAN ELEKTRONIK SANAYI VE TICARET ANONIM SIRKETI (Turkey)
ORTA DOGU TEKNIK UNIVERSITESI (Turkey)
Inventor
Gundogdu, Erhan
Alatan, Abdullah Aydin
Abstract
A method for learning deep convolutional features specifically designed for correlation filter based visual tracking includes the steps of, selecting a first image from a first image patch; selecting a second image from a second image patch; forward propagating selected first image by a convolutional neural network model formula, the formula has random weights with zero mean for the parameters; forward propagating selected second image by the convolutional neural network model formula; computing correlation filter using forward propagated second image and centered correlation response; circularly correlating forward propagated first image and computed correlation filter to generate predicted response map; calculating the loss by comparing the predicted response map with desired correlation corresponding selected first image and second image and updating the parameters of the convolutional neural network model formula according to calculated loss.
The invention is related to a system which enables to develop a LIDAR application by means of the rotation of optical elements that have been embedded on a rotating disk in a spherical geometry, which also enables to conduct the fastest possible spatial scanning mechanically and to determine the flight times of these light beams by means of adaptive elements according to the distance and size of the target region.
The present invention relates to a semiconductor photodiode (photodetector) which functions in a wide band range up to medium wave infrared and far wavelengths in addition to visible region and near infrared and comprises the doped state of black silicon with elements of chalcogen group (S(sulfur), Se(selenium) and Te(tellurium)); and obtaining method thereof.
The invention subject to the application is related to a method of establishing support structures used in additive manufacturing methods based on the material layering with extrusion principle with 3D printers, wherein the method is characterized in that additive manufacturing carried out by material layering with extrusion is performed in a recyclable particle tank (powder, sand, particle etc.).
B29C 64/118 - Processes of additive manufacturing using only liquids or viscous materials, e.g. depositing a continuous bead of viscous material using filamentary material being melted, e.g. fused deposition modelling [FDM]
The invention relates to a novel method for reducing the total operational load of the method of model predictive control (MPC) by conducting simplifications based on specific observations, in order to drive alternating current (AC) motors by using the method of MPC with a two-level voltage source inverter (2L-VSI).
Pichia pastoris alcohol oxidase 1 (AOX1) promoter variants are characterized by comprising at least one of the specified modifications on wild-type Pichia pastoris AOX1 promoter given by SEQUENCE No 1; said promoter variants include a mutation selecting from the group consisting of: a) integration of a Cat8 transcription factor binding site (TFBS), particularly integration of the ''TTCCGTTCGTCCGA'' gene sequence or other gene sequences that show at least 80% similarity with this sequence, at any positon within nucleotides 94 to 110 (-847 to -831), 141 to 160 (-800 to -781), 312 to 330 (-629 to -611), 355 to 380 (-586 to -561), 501 to 521 (-440 to -420); 640 to 658 (-301 to -283), 674 to 693 (-267 to -248), and 1 to 840 (-940 to -100); b) integration of Aca1 or Aca2 TFBS particularly integration of the "GCCTATTGTAGACGTCAACCC" nucleotide sequence or other gene sequences showing at least 80% similarity with this sequence at any position between the nucleotides 1 to 840 (-940 to -100); c) mutations specified with SEQUENCE No. 2 within nucleotides 94 to 693 (-847 to -248) and combinations thereof; and AOX1 promoter variants further characterized by their enhanced strenght and induction potential when compared with the wild-type AOX1 promoter.
Pichia pastorisPichia pastoris Pichia pastoris ADH2 promoter given by SEQUENCE No 1; said promoter variants include a mutation selecting from the group consisting of integration of a Cat8 transcription factor binding site (TFBS), particularly integration of the ''TTCCGTTCGTCCGA'' gene sequence or other gene sequences that show at least 80% similarity with this sequence, at any positon within nucleotides a) 647 to 660 (-401 to -388); b) 739 to 752 (-309 to -296); c) 1 to 948 (-1047 to -100); and d) mutations specified with SEQUENCE No. 2 within nucleotides 15 to 848 (-1033 to -200) seperately and combinations thereof; and ADH2 promoter variants further characterized by their enhanced strenght and induction potential when compared with the wild-type ADH2 promoter.
This invention is related to a method of producing nano and micro sized particles having anisotropic composition and/or morphology. This composition distribution can be on the surface (core-shell) or throughout the particle (coreless). The particles that are produced can be metal, inorganic, or combinations thereof; and these types of particles are known as hard anisotropic particles.
ASELSAN ELEKTRONİK SANAYİ VE TİCARET ANONİM ŞİRKETİ (Turkey)
ORTA DOĞU TEKNİK ÜNİVERSİTESİ (Turkey)
Inventor
Çöteli̇, Mert Burkay
Hacihabi̇boğlu, Hüseyin
Abstract
The invention is related to a method that enables acoustic source direction of arrival estimation and acoustic source separation, via spatial weighting of the dictionary based display of the steered response function calculated for a certain number of directions from spherical harmonic decomposition coefficients obtained from microphone array recordings of the sound field. The usage of spatial band limited functions of plane waves to represent more complex directional maps of the sound field constitutes the algorithm of the invention. These functions are calculated for pre-defined directions on an analysis surface (such as a sphere). The directions of arrival of sound sources are calculated with the same method in order to group source estimates to localize sound sources. Thereby, directions of arrival can be obtained from the recordings of the sound sources captured by means of a microphone array and following this, sound sources can be separated by using this direction information or predetermined source arrival directions.
G01S 3/00 - Direction-finders for determining the direction from which infrasonic, sonic, ultrasonic, or electromagnetic waves, or particle emission, not having a directional significance, are being received
90.
FULLY INTEGRATED OSCILLATOR FOR ULTRA LOW VOLTAGE APPLICATIONS WHICH QUADRUPLES VOLTAGE AND HAS LOW PHASE NOISE
The present invention is related to a self operating oscillator which increases an input DC voltage with a coefficient factor of 4 or more, by using a primary and a secondary LC tank in order to provide a differential sinusoidal output voltage which corresponds to high amplitude, low phase noise and high purity.
H03L 7/099 - Details of the phase-locked loop concerning mainly the controlled oscillator of the loop
H03B 5/12 - Generation of oscillations using amplifier with regenerative feedback from output to input with frequency-determining element comprising lumped inductance and capacitance active element in amplifier being semiconductor device
The present invention relates to a portable air conditioner is used to condition indoors and which can be integrated onto a door leaf basically comprising; an inner unit including a housing in the shape of a recess with a suitable size to allow the inner unit to fit into the door leaf, and an opening that is integrated to the door leaf and is used in the area to be conditioned, an outer unit that is used such as to be outside the area to be conditioned, a body that extends between bottom portions of the inner unit and the outer unit and includes a connection path connecting the inner unit and the outer unit to each other, and at least two wheels that are located at the bottom of the body which are used to move the body.
The invention is related to a "nondiscriminatory access system for public/collective living spaces" which eases the access problems for the disabled without asking for assistance in said public/collective living spaces, where the boarding platform is higher or lower than the ground level.
ASELSAN ELEKTRONIK SANAYI VE TICARET ANONIM SIRKETI (Turkey)
ORTA DOGU TEKNIK UNIVERSITESI (Turkey)
Inventor
Gundogdu, Erhan
Alatan, Abdullah Aydin
Abstract
With the present application, a method for learning deep convolutional features specifically designed for correlation filter based visual tracking is provided. Said method comprises the steps of, selecting a first image (xi) from a first image patch; selecting a second image (yi) from a second image patch; forward propagating selected first image (xi) (101 ) by a convolutional neural network model formula (ƒθ(. )), wherein said formula has random weights with zero mean for the parameters (θ); forward propagating selected second image (yi) (102) by said convolutional neural network model formula ((ƒθ(. )); computing correlation filter using forward propagated second image (yi) and centered correlation response (ci) (103); circularly correlating forward propagated first image (xi) and computed correlation filter (104) to generate predicted response map (105); calculating the loss (106) by comparing the predicted response map (105) with desired correlation (gi) corresponding selected first image (xi) and second image (yi) and updating the parameters (θ) of said convolutional neural network model formula ((ƒθ(. )) according to calculated loss (107).