Abrégé

A high-performance object detection system using HDR images obtained from LDR cameras, which allows for the separation and recognition of detected objects in images under high illumination difference conditions (tunnels, sunrise or sunset, etc.) and prevents autonomous vehicles from causing undesired accidents is provided.

Classes IPC  ?

• G06V 10/70 - Dispositions pour la reconnaissance ou la compréhension d’images ou de vidéos utilisant la reconnaissance de formes ou l’apprentissage automatique
• G06T 5/50 - Amélioration ou restauration d'image utilisant plusieurs images, p. ex. moyenne ou soustraction
• G06T 5/92 - Modification de la plage dynamique d'images ou de parties d'images basée sur les propriétés globales des images
• G06V 10/32 - Normalisation des dimensions de la forme

Abrégé

A mini slotted random access protocol with an age threshold is used only by terminals that exceed the threshold value in terms of age of information, and has different probabilities of transmission in each mini slot in the protocol, the user population is shaped such that the age of information is minimized.

Classes IPC  ?

• H04W 74/0833 - Procédures d’accès aléatoire, p. ex. avec accès en 4 étapes

Abrégé

Near-infrared (NIR) absorbing photosensitizers for imaging and treatment of cancer in a photodynamic therapy (PDT) are provided. Specifically, the NIR photosensitizers are mitochondria targeted and water-soluble, and used as a cytotoxic drug in a photodynamic therapy of the cancer. The NIR photosensitizers are activated with wavelengths of light, wherein the light penetrates through a body not just a skin. Hence the NIR photosensitizers aim to transform PDT from being a specialized treatment to a generally applicable one. PDT is almost completely non-invasive compared to current treatment methods.

Classes IPC  ?

• A61K 41/00 - Préparations médicinales obtenues par traitement de substances par énergie ondulatoire ou par rayonnement corpusculaire
• C07F 5/02 - Composés du bore
• C07F 7/08 - Composés comportant une ou plusieurs liaisons C—Si

Abrégé

A novel capacitive micromachined ultrasonic transducer (CMUT) array is provided and the CMUT array employs an additional electrically-addressable conductive shield that isolates each array element individually, hence the novel array is coined as Faraday Caged CMUT array. The state of this conductive shield corresponding to each array element can be set as floating for reduced parasitic and cross-coupling capacitance or grounded for reduced electrical crosstalk. Perpetual, reliable operation in floating state without the risk of catastrophic dielectric electric field breakdown event is enabled by the self-discharging mechanism through diamond emitters featuring high field emission efficiency and acting as lightning rods in a cavity. The lightning rod structure features a movable diamond membrane, which deflects towards the diamond emitter due to electrostatic force (acting as a charge-controlled capacitive device) closing the gap to facilitate the safe intermittent discharging.

Classes IPC  ?

• B06B 1/02 - Procédés ou appareils pour produire des vibrations mécaniques de fréquence infrasonore, sonore ou ultrasonore utilisant l'énergie électrique
• A61B 8/00 - Diagnostic utilisant des ondes ultrasonores, sonores ou infrasonores

Abrégé

The invention relates to new 1-bit quantization and detection methods in uplink massive multiple input multiple output (MIMO) systems equipped with 1-bit analog-to-digital converters (ADCs).

Classes IPC  ?

• H04B 7/0413 - Systèmes MIMO
• H04B 7/06 - Systèmes de diversitéSystèmes à plusieurs antennes, c.-à-d. émission ou réception utilisant plusieurs antennes utilisant plusieurs antennes indépendantes espacées à la station d'émission

Abrégé

The invention is related to new quantization and detection methods for uplink massive multiple-input multiple-output (MIMO) - Orthogonal Frequency Division Multiplexing (OFDM) systems equipped with a 1-bit analog-to-digital converters (ADCs).

Classes IPC  ?

• H04L 27/18 - Systèmes à courant porteur à modulation de phase, c.-à-d. utilisant une manipulation à décalage de phase

Abrégé

The invention relates to a fabrication method for the substrate in which the sample to be tested in surface enhanced Raman spectroscopy is placed.

Classes IPC  ?

• G01N 21/65 - Diffusion de Raman

Abrégé

The invention is related with 2D passivation layer providing radical impact of electronic and steric effects on performance of 3D/2D perovskite solar cells.

Classes IPC  ?

• H10K 30/00 - Dispositifs organiques sensibles au rayonnement infrarouge, à la lumière, au rayonnement électromagnétique de plus courte longueur d'onde ou au rayonnement corpusculaire

Abrégé

The invention relates to a high-resolution dispersion-based LIDAR imaging system.

Classes IPC  ?

• G01S 7/481 - Caractéristiques de structure, p. ex. agencements d'éléments optiques
• G01S 17/89 - Systèmes lidar, spécialement adaptés pour des applications spécifiques pour la cartographie ou l'imagerie

Abrégé

The invention relates to a method comprising a quantum-resistant lattice-based accountable subgroup multi-signature scheme.

Classes IPC  ?

• H04L 9/32 - Dispositions pour les communications secrètes ou protégéesProtocoles réseaux de sécurité comprenant des moyens pour vérifier l'identité ou l'autorisation d'un utilisateur du système

Abrégé

A compact holographic SLM spectrometer without an optical diffraction element is provided. The compact holographic SLM spectrometer performs the basic spectrometer function using a spatial light modulator (SLM). The compact holographic SLM spectrometer includes a light source, an input element, a collimator, an SLM, an analysis and detection optics, at least one detector, and a digital and/or analog control device.

Classes IPC  ?

• G01J 3/02 - SpectrométrieSpectrophotométrieMonochromateursMesure de la couleur Parties constitutives
• G01J 3/12 - Production du spectreMonochromateurs
• G01J 3/453 - Spectrométrie par interférence par corrélation des amplitudes
• G03H 1/22 - Procédés ou appareils pour obtenir une image optique à partir d'un hologramme

Abrégé

A powering system for constant current neural stimulators provides adaptive supply voltage for neural stimulators to decrease power dissipation by taking advantage of varying voltage compliance of constant current stimulation. The powering system includes an adaptive voltage supply generator, a monitoring circuit, a charge pump, a step-down converter, and a rechargeable battery.

Classes IPC  ?

• A61N 1/36 - Application de courants électriques par électrodes de contact courants alternatifs ou intermittents pour stimuler, p. ex. stimulateurs cardiaques
• A61N 1/378 - Alimentation en courant électrique
• H02M 3/155 - Transformation d'une puissance d'entrée en courant continu en une puissance de sortie en courant continu sans transformation intermédiaire en courant alternatif par convertisseurs statiques utilisant des tubes à décharge avec électrode de commande ou des dispositifs à semi-conducteurs avec électrode de commande utilisant des dispositifs du type triode ou transistor exigeant l'application continue d'un signal de commande utilisant uniquement des dispositifs à semi-conducteurs

Classes IPC  ?

• A61K 38/00 - Préparations médicinales contenant des peptides

Abrégé

The invention is related to copolymers, method of synthesis thereof and solar cells where these copolymers are used as donors.

Classes IPC  ?

• C08G 61/12 - Composés macromoléculaires contenant d'autres atomes que le carbone dans la chaîne principale de la macromolécule

Abrégé

In particular, the invention relates to absorber material that reduces the harmful effects of neutron beams and gamma rays by absorbing neutron beams and secondary gamma and alpha rays generated by the absorption of neutron beams.

Classes IPC  ?

• G21F 1/00 - Blindage caractérisé par la composition du matériau
• C08L 23/06 - Polyéthylène
• C08K 3/38 - Composés contenant du bore
• C08K 3/22 - OxydesHydroxydes de métaux

Abrégé

A phase shifter circuit (1), which creates a delay in a signal by changing the phase of the said signal, essentially comprising at least one base (2); at least one main line (3) made of a conductive material positioned on or within the base (2) and having an input end (4) and an output end (5) for signal input and output; a plurality of gaps (6) for trapping the signal transmitted over the main line (3); a plurality of conductive parts (8) positioned spaced apart from each other by a certain aperture, switching elements (9), which are located between each conductive part (8) and the main line (3), and control the electrical contact of the conductive parts (8) with the main line (3), and at least one control unit (10) adapted to control the switching elements (9) so as to create a delay in the said signal by trapping the said signal in the apertures between the conductive parts (8).

Classes IPC  ?

• H01P 1/18 - Déphaseurs
• H01P 1/10 - Dispositifs commutateurs ou interrupteurs

Abrégé

A method for performance determination of a heat pipe with an arbitrary liquid flow area and prescribed geometric dimensions, an external and internal structure, a heat pipe material and a working fluid, heating and cooling surface areas, and condenser cooling conditions is provided to obtain operating and performance parameters, wherein the operating and performance parameters are temperature distribution within the heat pipe, a heat transferred via a phase change and a conduction, an axial variation of a radius of curvature of a liquid-vapor interface along the heat pipe, a vapor temperature and pressure of the working fluid, by simulating a flow and an energy transfer inside.

Classes IPC  ?

• B23P 15/26 - Fabrication d'objets déterminés par des opérations non couvertes par une seule autre sous-classe ou un groupe de la présente sous-classe d'échangeurs de chaleur

Abrégé

A high-resolution optical spectrometer with multiple diffractive optical elements operates under broadband light and enables spectral splitting with 3D diffractive optical elements. Diffractive optical elements are used to provide concentration of light as well as spectral splitting. Depending on the application, the high-resolution optical spectrometer operates with a reflection or transmission diffractive optical element. The number of operating wavelengths, spectral resolution, and operating bandwidth of diffractive optical elements are flexible depending on application.

Classes IPC  ?

• G01J 3/02 - SpectrométrieSpectrophotométrieMonochromateursMesure de la couleur Parties constitutives
• G02B 23/06 - Télescopes ou lunettes d'approche, p. ex. jumellesPériscopesInstruments pour voir à l'intérieur de corps creuxViseursPointage optique ou appareils de visée comprenant des prismes ou des miroirs ayant une action de mise au point, p. ex. miroir parabolique

Abrégé

A modal superposition method using a response dependent non-linear mode concept for a vibration analysis of non-linear engineering structures is provided. The modal superposition method is provided to find steady state response of non-linear systems in frequency domain. The modal superposition method is used in many mechanical structures, especially in design of aerospace and automotive structures, defense industry platforms, steam and gas turbines and mechanical structures containing non-linear forces such as gas turbine engines and jet engines.

Classes IPC  ?

• G06F 17/11 - Opérations mathématiques complexes pour la résolution d'équations
• G06F 17/16 - Calcul de matrice ou de vecteur
• G06F 17/14 - Transformations de Fourier, de Walsh ou transformations d'espace analogues
• G06F 30/23 - Optimisation, vérification ou simulation de l’objet conçu utilisant les méthodes des éléments finis [MEF] ou les méthodes à différences finies [MDF]

Abrégé

The invention relates to a method or methods comprising pairing-based accountable subgroup multi- signature schemes.

Classes IPC  ?

• H04L 9/32 - Dispositions pour les communications secrètes ou protégéesProtocoles réseaux de sécurité comprenant des moyens pour vérifier l'identité ou l'autorisation d'un utilisateur du système

Abrégé

The present invention is intended to perform rotary wing drone (UAV) detection in the urban environment with low-power, low-cost radar systems. The system proposed in the invention, rotary wing drones (UAVs) perform classification before detection and positioning. Therefore, a large number of moving targets such as urban environments are filtered before detection.

Classes IPC  ?

• G01S 7/41 - Détails des systèmes correspondant aux groupes , , de systèmes selon le groupe utilisant l'analyse du signal d'écho pour la caractérisation de la cibleSignature de cibleSurface équivalente de cible

Abrégé

The present invention relates to a high-performance object detection system using HDR images obtained from LDR cameras, which allows for the separation and recognition of detected objects in images under high illumination difference conditions (tunnels, sunrise or sunset, etc.) and prevents autonomous vehicles from causing undesired accidents.

Classes IPC  ?

• G06K 9/00 - Méthodes ou dispositions pour la lecture ou la reconnaissance de caractères imprimés ou écrits ou pour la reconnaissance de formes, p.ex. d'empreintes digitales
• B60W 50/00 - Détails des systèmes d'aide à la conduite des véhicules routiers qui ne sont pas liés à la commande d'un sous-ensemble particulier
• B60W 60/00 - Systèmes d’aide à la conduite spécialement adaptés aux véhicules routiers autonomes
• G06V 10/00 - Dispositions pour la reconnaissance ou la compréhension d’images ou de vidéos
• G06N 20/00 - Apprentissage automatique
• G06T 7/00 - Analyse d'image
• G06V 20/60 - Type d’objets
• G06T 5/00 - Amélioration ou restauration d'image

Abrégé

The invention relates to biocompatible micron-scale spherical or non-spherical materials that can selectively separate bacterial cells from blood and various other liquids, and the synthesis methods thereof.

Classes IPC  ?

• A61K 47/00 - Préparations médicinales caractérisées par les ingrédients non actifs utilisés, p. ex. les supports ou les additifs inertesAgents de ciblage ou de modification chimiquement liés à l’ingrédient actif
• A61K 49/00 - Préparations pour examen in vivo
• A61K 49/18 - Préparations de contraste pour la résonance magnétique nucléaire [RMN]Préparations de contraste pour l'imagerie par résonance magnétique [IRM] caractérisées par un aspect physique particulier, p. ex. émulsions, microcapsules, liposomes

Abrégé

The invention relates to a method for fast phase modulation comprising at least one diffractive optical element (DOE) and a Digital Micromirror Device (1) for controlling the spatial phase of light emitted from a light source (4). The invention is characterized in that it comprises at least one first optical element (9) through which light coming from the light source (4) passes, at least one transparent diffractive optical element (10), and/or reflective diffractive optical element (11) located before or after the Digital Micromirror Device (1) and providing phase modulation of the light passing through the optical elements (9), at least one second optical element (9.1), which is used to reduce the post-modulation light to the target region (13), at least one data acquisition and/or controller element (12) for controlling the light reaching the target region (13).

Classes IPC  ?

• G02B 27/00 - Systèmes ou appareils optiques non prévus dans aucun des groupes ,

Abrégé

The present invention relates to a high-resolution, high signal-to-noise ratio and high-bandwidth spectrometer that uses a multimode scattering medium. The spectrometer idea proposed in the present invention is an inventive notion that is based on the property of multiple interference and that aims to use a multimode waveguide and/or a multimode scattering medium together with a method for shaping light by using SLM. A spatial light modulator (SLM) used either before or after the fiber enables focusing or increasing the amount of light that is received at the detector. The resolution of the spectrometer to be build is determined by means of measuring the extent of the change in the wavelength of the incident light that will result in disruption of the focus created in the detector. It is concluded that the achieved resolution is exceedingly high because of the fact that the focus to be obtained by means of SLMs is a sharp focus with high intensity and that the sharper said focus becomes, the dependency thereof on the change occurring in the wavelength will be more precise. Subsequently, the optimized phase patterns required for different wavelengths are written over the SLM, thereby ensuring that each wavelength is focused, or the amount of light is increased, meanwhile the SLM phase pattern that forms each focus is recorded, creating a calibration dataset. This dataset may also be created by employing a method that is based on artificial intelligence. For a light source with an unknown spectrum, the prerecorded optimized phase patterns are individually written over the SLM, and the intensity of light generated on the detector is measured. Thus, a spectrometer is built by means of obtaining the change of light intensity depending on the wavelength as the data that relates to which wavelength belongs to each one of the phase patterns on the SLM is already available. As the SLM used herein may be preprogrammed with respect to which wavelength of light is transmitted or reflected depending on the which pattern is written thereon, the programming may also be changed dynamically during the respective experiments according to the design of the spectrometer. For the case that the light source that is being used is incoherent, by adding a time modulator to the input section of the spectrometer assembly, the spectrometer that permits achieving a higher rate of diversity in light sources can be achieved.

Classes IPC  ?

• G01J 3/00 - SpectrométrieSpectrophotométrieMonochromateursMesure de la couleur

Abrégé

The invention relates to an integrated acoustophoretic microfluidic device (EAMC) in which integrated two or more step operations to be applied to micro and/or biological particles can be performed in a single microfluidic system using the acoustophoresis method in at least two of these. The device that is the subject of the invention has a multi-layer structure, contains an insulating layer that will act as an acoustic insulator between the layers, and allows a microfluidic unit operating with a different acoustic frequency to be placed in each layer. Thus, an acoustofluidic device is presented that is both reasonable in size and allows multi-stage micro and/or biological particle manipulation.

Classes IPC  ?

• G01N 29/02 - Analyse de fluides
• H03H 9/02 - Réseaux comprenant des éléments électromécaniques ou électro-acoustiquesRésonateurs électromécaniques Détails

Abrégé

This invention is related to the calculation of nonlinear normal modes of large ordered structures by using a receptance based method.

Classes IPC  ?

• G06F 30/23 - Optimisation, vérification ou simulation de l’objet conçu utilisant les méthodes des éléments finis [MEF] ou les méthodes à différences finies [MDF]

Abrégé

The invention is related to a thorax impactor (1) which will represent the thorax area of the pedestrians' body and provide for the evaluation of pedestrian injuries caused by flat front vehicles in tests, comprising a rear bracket (8) representing the spine.

Classes IPC  ?

• G09B 23/30 - Modèles anatomiques
• G01M 7/08 - Test de résistance au choc

Abrégé

The invention relates to a LIDAR imaging system, that comprising at least one light source (100) which enables illumination of the target (150) to be imaged and which provides the illumination time information, developed to obtain high resolution depth information.

Classes IPC  ?

• G01S 17/89 - Systèmes lidar, spécialement adaptés pour des applications spécifiques pour la cartographie ou l'imagerie
• G01S 7/481 - Caractéristiques de structure, p. ex. agencements d'éléments optiques

Abrégé

The invention relates to a LIDAR device that can scan with a single structure in both vertical and horizontal planes. The invention is characterized in that it comprises at least one light source (110) sending the beam to scan the scanned area (130), at least one multi-surface scanner (100) enabling the transmission of the incident beams (101) sent from the said light source (110) to the scanned area (130) and at least one reflective optical component (140) placed at different angles on each surface of the said multi-surface scanner (100), at least one detector component (111) enabling the detection of the reflected beams (102) from the scanned area (130) and calculating the flight time of the beam sent, at least one control unit (150) to control the said light source (110), the multi-surface scanner (100) and the detector component (111) and connected to them by at least one signal/data transmission line (151), at least one rotating system (120) to move the said multi-surface scanner (100) circularly to different points of the space, and at least one linear movement system (121) to move the said multi-surface scanner (100) to axially in a direction different from the rotational axis.

Classes IPC  ?

• G01S 17/08 - Systèmes déterminant les données relatives à la position d'une cible pour mesurer la distance uniquement
• G01S 7/00 - Détails des systèmes correspondant aux groupes , ,

Abrégé

The invention relates to a fitting system for fully implantable middle ear implant which uses acoustic waves to tune cochlear implant device according to patient comfort.

Classes IPC  ?

• H04R 25/00 - Appareils pour sourds
• A61N 1/00 - ÉlectrothérapieCircuits à cet effet

Abrégé

A new method, Jacobian Element Method (JEM), is proposed for numerical or analytical calculation of the Jacobian matrix in the solution of nonlinear multi-degree of freedom (MDOF) systems.

Classes IPC  ?

• G06F 17/11 - Opérations mathématiques complexes pour la résolution d'équations
• G06F 30/23 - Optimisation, vérification ou simulation de l’objet conçu utilisant les méthodes des éléments finis [MEF] ou les méthodes à différences finies [MDF]

Abrégé

The invention relates to a novel link layer protocol.

Classes IPC  ?

• H04W 74/08 - Accès non planifié, p. ex. ALOHA
• H04W 4/70 - Services pour la communication de machine à machine ou la communication de type machine
• H04W 84/18 - Réseaux auto-organisés, p. ex. réseaux ad hoc ou réseaux de détection

Abrégé

An MEMS airborne ultrasonic transducer system operating on a thermoacoustic principle to determine brain haemorrhage, includes: an RF transmitter and ultrasound receiver systems to transmit RF energy and receive ultrasound wave, respectively, an RF transmitter system having an RF signal generator, an RF amplifier and a horn antenna, and an ultrasound receiver system having a lock-in amplifier, a DC supply and two ultrasonic transducer arrays wirebonded to low noise amplifier (LNA) chips. The MEMS airborne ultrasonic transducer system determines brain haemorrhage based on detecting RF-induced, blood-originating, thermoacoustic ultrasound wave at the pulse modulation frequency.

Classes IPC  ?

• A61B 5/02 - Détection, mesure ou enregistrement en vue de l'évaluation du système cardio-vasculaire, p. ex. mesure du pouls, du rythme cardiaque, de la pression sanguine ou du débit sanguin
• A61B 5/00 - Mesure servant à établir un diagnostic Identification des individus
• B06B 1/02 - Procédés ou appareils pour produire des vibrations mécaniques de fréquence infrasonore, sonore ou ultrasonore utilisant l'énergie électrique

Abrégé

This invention introduces a novel capacitive micromachined ultrasonic transducer (CMUT) array employing an additional electrically-addressable conductive shield that isolates each array element individually, hence the novel array is coined as Faraday Caged CMUT array. The state of this conductive shield corresponding to each array element can be set as floating for reduced parasitic and cross-coupling capacitance or grounded for reduced electrical crosstalk. Perpetual, reliable operation in floating state without the risk of catastrophic dielectric electric field breakdown event is enabled by the self-discharging mechanism through diamond emitters featuring high field emission efficiency and acting as lightning rods in a cavity. The lightning rod structure features a movable diamond membrane, which deflects towards the diamond emitter due to electrostatic force (acting as a charge-controlled capacitive device) closing the gap to facilitate the safe intermittent discharging.

Classes IPC  ?

• B60B 1/02 - Roues à rayons, métalliques ou non métalliques, sous tension
• B60B 1/06 - Roues à rayons en compression
• H01L 27/20 - Dispositifs consistant en une pluralité de composants semi-conducteurs ou d'autres composants à l'état solide formés dans ou sur un substrat commun comprenant des composants magnétostrictifs

Abrégé

The invention relates to a method for obtaining membrane and other functional films by aligned deposition of nanorod structured materials on porous surfaces via cross flow.

Classes IPC  ?

• B82Y 30/00 - Nanotechnologie pour matériaux ou science des surfaces, p. ex. nanocomposites

Abrégé

A spherically steerable microphone array structure is provided. The spherically steerable microphone array structure uses pressure and acoustic particle velocity signals obtained from sensors positioned co-planarly on a circular arc. The spherically steerable microphone array structure allows a calculation of all spatial partial derivatives of a sound field up to a given order. The spatial partial derivatives are used to obtain a spherical harmonic decomposition of a recorded sound field. Spherical harmonic decomposition coefficients are used in a spherically direction-invariant acoustic mode beamforming.

Classes IPC  ?

• H04R 3/00 - Circuits pour transducteurs
• H04R 1/40 - Dispositions pour obtenir la fréquence désirée ou les caractéristiques directionnelles pour obtenir la caractéristique directionnelle désirée uniquement en combinant plusieurs transducteurs identiques

Abrégé

This invention is related to a with low-cost new design of ultra-high sensitive fiber optic pressure and strain sensors with fiber loop ringdown spectroscopy technique, and its property; having a LED light source (1) with a central wavelength of 1550 nm., optical lens (2) assembly to send the light pulse with minimum optical loss, a collimator (3) that allows the light to travel on a specific direction without deviation, a fiber loop (5) allows high sensitive measurement due to travelling incoming light from the collimator (3) several round in the loop, couplers (4) provides the light beam separation into the fiber loop (5) in different ratios such as 99.9:0.1, 99:1 to 90:10, a power meter (8) provides measurement of the signal coming from the fiber loop (5) by power meter sensor (7), a power supply (10) provides the electrical supply of all electronic components in the system, and includes the computer (9) or tablet (11), which processes the measured values by means of software according to the graphical analysis method.

Classes IPC  ?

• G01J 3/02 - SpectrométrieSpectrophotométrieMonochromateursMesure de la couleur Parties constitutives

Abrégé

The invention relates to a single PDMS layered pumpless microfluidic system in which the continuity of the spermatogonial stem cell maintenance and their microenvironment in the testicle in vitro is ensured.

Classes IPC  ?

• C12M 3/00 - Appareillage pour la culture de tissus, de cellules humaines, animales ou végétales, ou de virus

Abrégé

This invention is related to the synthesis, characterization and investigation of electrochemical performance of new metal-doped layered sodium (lithium, potassium) metal oxides containing nickel, iron and manganese used as cathode active material in sodium (lithium, potassium) ion batteries with a new method. The layered sodium metal oxides can be used as cathode active material in rechargeable batteries and supercapacitor electrodes.

Classes IPC  ?

• C25B 11/00 - ÉlectrodesLeur fabrication non prévue ailleurs

Abrégé

A recycling method of polylactic acid in a single step by using supercritical or dense gas carbon dioxide is provided. The recycling method includes the steps of adjusting a temperature of a reactor to at least 120° C., and adjusting a pressure to values above or below a critical pressure of carbon dioxide, wherein the critical pressure is 73.8 bar.

Classes IPC  ?

• C07D 319/12 - Dioxanes-1, 4Dioxanes-1, 4 hydrogénés non condensés avec d'autres cycles

Abrégé

The invention relates to which is related to a powering system for constant current neural stimulators that provides adaptive supply voltage for neural stimulators to decrease power dissipation by taking advantage of varying voltage compliance of constant current stimulation.

Classes IPC  ?

• A61N 1/36 - Application de courants électriques par électrodes de contact courants alternatifs ou intermittents pour stimuler, p. ex. stimulateurs cardiaques
• A61N 1/00 - ÉlectrothérapieCircuits à cet effet

Abrégé

This invention relates to the very rapid detection of SARS-CoV-2 virus, which causes COVID-19 disease, from breath using fiber optic sensors to which ultra-high sensitivity fiber ring loop damping spectroscopy (FHDSS) technique is applied. The invention is based on the application of fiber ring loop damping spectroscopy fiber optic sensor and sensor for the diagnosis of SARS-COV-2 virus from breath by collecting human breaths with breath collection bags and transporting them to the laboratory environment, which includes a sensor device for spectroscopic measurement, or by transporting the portable FRLDS fiber optic sensor system to the patient environment. Method, and its feature is that it consists of the following process steps: Preparation of the aminosilane reagent solution using acetone and keeping the sensor head (6) in this solution (200), Amine sililated sensor head (6), attaching SARS-CoV-2 IgG antibody to its surface (300), is the testing of breath samples from COVID-19 patients by sending them to the FRLDS (400) system with the SARS-CoV-2 IgG antibody attached sensor head (6).

Classes IPC  ?

• C12Q 1/00 - Procédés de mesure ou de test faisant intervenir des enzymes, des acides nucléiques ou des micro-organismesCompositions à cet effetProcédés pour préparer ces compositions
• C12Q 1/68 - Procédés de mesure ou de test faisant intervenir des enzymes, des acides nucléiques ou des micro-organismesCompositions à cet effetProcédés pour préparer ces compositions faisant intervenir des acides nucléiques
• C12Q 1/6876 - Produits d’acides nucléiques utilisés dans l’analyse d’acides nucléiques, p. ex. amorces ou sondes
• G01N 21/00 - Recherche ou analyse des matériaux par l'utilisation de moyens optiques, c.-à-d. en utilisant des ondes submillimétriques, de la lumière infrarouge, visible ou ultraviolette
• G01N 33/569 - Tests immunologiquesTests faisant intervenir la formation de liaisons biospécifiquesMatériaux à cet effet pour micro-organismes, p. ex. protozoaires, bactéries, virus

Abrégé

The invention is a closed and integrated NFR platform (12) for inspection of radiation transfer at micro-nano scale, and comprises of an emitter (5) comprises of a silicon carbide thin film (2) coated on a silicon substrate (1), a receiver (6) comprising a silicon carbide thin film (2) coated on a silicon substrate (1). The silicon carbide thin films (2) of the emitter (5) and the receiver (6) are coated and bonded under vacuum along their patterned contact surfaces, silicon dioxide intermediate pillars such that distance between the emitter (5) and the receiver (6) is smaller than thermal radiation wavelength and parallel to each other. The attained integrated structure (7) at wafer size is diced to obtain 3cmx3cm chips. The fabrication method of the NFR platform (12) is within the scope of the invention.

Classes IPC  ?

• H01L 31/00 - Dispositifs à semi-conducteurs sensibles aux rayons infrarouges, à la lumière, au rayonnement électromagnétique d'ondes plus courtes, ou au rayonnement corpusculaire, et spécialement adaptés, soit comme convertisseurs de l'énergie dudit rayonnement e; Procédés ou appareils spécialement adaptés à la fabrication ou au traitement de ces dispositifs ou de leurs parties constitutives; Leurs détails
• H01L 31/18 - Procédés ou appareils spécialement adaptés à la fabrication ou au traitement de ces dispositifs ou de leurs parties constitutives
• B81C 1/00 - Fabrication ou traitement de dispositifs ou de systèmes dans ou sur un substrat

Abrégé

The invention relates to a compact holographic SLM spectrometer without an optical diffraction element. The invention performs the basic spectrometer function using a spatial light modulator (SLM).

Classes IPC  ?

• G01J 3/02 - SpectrométrieSpectrophotométrieMonochromateursMesure de la couleur Parties constitutives
• G03H 1/02 - Procédés ou appareils holographiques utilisant la lumière, les infrarouges ou les ultraviolets pour obtenir des hologrammes ou pour en obtenir une imageLeurs détails spécifiques Détails
• G03H 1/22 - Procédés ou appareils pour obtenir une image optique à partir d'un hologramme

Abrégé

22) as binder, pozzolanic additive, and wheat straw as a bio-aggregate, that provides sound and thermal insulation. Multi-layered and multifunctional plaster systems or insulation board systems are produced according to the purpose, with mortars having different "bindenpozzolanic additive:bio- aggregate" ratios.

Classes IPC  ?

• C04B 28/14 - Compositions pour mortiers, béton ou pierre artificielle, contenant des liants inorganiques ou contenant le produit de réaction d'un liant inorganique et d'un liant organique, p. ex. contenant des ciments de polycarboxylates contenant des ciments de sulfate de calcium
• C04B 28/02 - Compositions pour mortiers, béton ou pierre artificielle, contenant des liants inorganiques ou contenant le produit de réaction d'un liant inorganique et d'un liant organique, p. ex. contenant des ciments de polycarboxylates contenant des ciments hydrauliques autres que ceux de sulfate de calcium

Abrégé

The present invention is related to a method and a product developed to solve the chatter problem in milling processes in machining centers.

Classes IPC  ?

• B23Q 11/00 - Accessoires montés sur les machines-outils pour maintenir les outils ou les organes de la machine dans de bonnes conditions de travail ou pour refroidir les pièces travailléesDispositifs de sécurité spécialement combinés aux machines-outils, disposés dans ces machines ou spécialement conçus pour être utilisés en relation avec ces machines
• B23Q 17/12 - Agencements sur les machines-outils pour indiquer ou mesurer pour indiquer ou mesurer les vibrations

Abrégé

A fiber optic MEMS microphone featuring an electrically deflectable MEMS membrane via a conversion of an optical energy propagating in an optical fiber cable to an electrical energy with a photodiode chip. The fiber optic MEMS microphone includes a MEMS device, the photodiode chip, a voltage, a power adjustable laser beam and a light.

Classes IPC  ?

• H04R 23/00 - Transducteurs autres que ceux compris dans les groupes

Abrégé

The invention relates to a method for performance determination of a heat pipe with arbitrary liquid flow area and prescribed geometric dimensions, external and internal structure, heat pipe material and working fluid, heating and cooling surface areas, condenser cooling conditions to obtain operating and performance parameters (temperature distribution within the heat pipe, the heat transferred via phase change and conduction, the axial variation of the radius of curvature of the liquid-vapor interface along the heat pipe, the vapor temperature and pressure of the working fluid) by simulating the flow and energy transfer inside.

Classes IPC  ?

• F28D 15/02 - Appareils échangeurs de chaleur dans lesquels l'agent intermédiaire de transfert de chaleur en tubes fermés passe dans ou à travers les parois des canalisations dans lesquels l'agent se condense et s'évapore, p. ex. tubes caloporteurs

Abrégé

The present invention relates to a meta tag generation method that effectively trains deep learning-based systems on dirty data sets. New tags are produced for dirty data by using a limited number of known clean data. The system to be used for computer vision is trained by means of generated tags instead of dirty tags. In this way, reduction in performance caused by dirty tags will be prevented. Furthermore, the proposed method can be used on untagged data. It allows training on datasets consisting of a combination of clean-tagged, dirty-tagged and untagged data with this aspect.

Classes IPC  ?

• G06N 3/08 - Méthodes d'apprentissage
• G06N 3/04 - Architecture, p. ex. topologie d'interconnexion

Abrégé

The invention relates to a damping element consisting of viscoelastic material and designed for damping wind turbine vibrations and increasing fatigue life of the structure.

Classes IPC  ?

• F03D 13/00 - Assemblage, montage ou mise en route de mécanismes moteurs à ventDispositions spécialement adaptées au transport de composants de mécanismes moteurs à vent
• F03D 80/00 - Détails, composants ou accessoires non prévus dans les groupes
• F16F 7/00 - Amortisseurs de vibrationsAmortisseurs de chocs
• F16F 15/00 - Suppression des vibrations dans les systèmesMoyens ou dispositions pour éviter ou réduire les forces de déséquilibre, p. ex. dues au mouvement

Abrégé

2 2 and/or air.

Classes IPC  ?

• B01D 71/80 - Polymères séquencés

Abrégé

A semiconductor photodiode which functions in a wide band range up to medium wave infrared and far wavelengths in addition to visible region and near infrared includes: a light absorber region in micro structure which can provide light absorbance upon being roughened by laser; a first electrical lower contact coated with metal materials such as aluminium (Al), silver (Ag); a silicon which consists of crystalline silicon (c-Si); a second electrical lower contact which is coated with metal materials such as aluminium (Al), silver (Ag); a chalcogen doped hyper-filled silicone region which is obtained as a result of doping by pulse laser to the silicone region implanted by chalcogen elements; and upper electrical contact parts which are coated generally in the thickness range of 10 nm-1000 nm by using two-layered alloys with aluminium (Al)—(Al)-silver (Ag), two-layered alloys with titanium (Ti)-gold (Au), three-layered alloys with Ti-Platinum(Pt)—Au—Ag or three-layered alloys with Ti-lead(Pb)—Ag.

Classes IPC  ?

• H01L 31/103 - Dispositifs sensibles au rayonnement infrarouge, visible ou ultraviolet caractérisés par une seule barrière de potentiel ou de surface la barrière de potentiel étant du type PN à homojonction
• H01L 31/0224 - Electrodes
• H01L 31/0236 - Textures de surface particulières
• H01L 31/0288 - Matériaux inorganiques comprenant, à part les matériaux de dopage ou autres impuretés, uniquement des éléments du groupe IV de la classification périodique caractérisés par le matériau de dopage
• H01L 31/18 - Procédés ou appareils spécialement adaptés à la fabrication ou au traitement de ces dispositifs ou de leurs parties constitutives

Abrégé

Pichia pastoris alcohol oxidase 1 (AOX1) promoter variants include at least one of the specified modifications on wild-type Pichia pastoris AOX1 promoter (SEQ ID NO: 1). The modifications include the following: a) integration of a Cat8 transcription factor binding site (TFBS), particularly integration of SEQ ID NO: 6 or SEQ ID NO: 7 or other gene sequences that show at least 80% similarity with these sequences, at any position within nucleotides 94 to 110, 141 to 160, 312 to 330, 355 to 380, 501 to 521; 640 to 658, 674 to 693, and 1 to 840; b) integration of Aca1 or Aca2 TFBS particularly integration of SEQ ID NO: 8 or other gene sequences showing at least 80% similarity with this sequence at any position between the nucleotides 1 to 840; c) mutations specified with SEQ ID NO: 2 within nucleotides 94 to 693 and combinations thereof.

Classes IPC  ?

• C12N 15/81 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes eucaryotes pour champignons pour levures

Abrégé

The invention relates to a method of producing zeolite 3A and zeolite 5A directly, in which aluminasilicates such as sodium feldspar, halloysite, kaolin, pyrophyllite and/or natural zeolites are used, in addition to this, natural sources of calcite, which is a source of calcium, and potash, which is a source of potassium, are used respectively, without requiring any ion exchange process.

Classes IPC  ?

• C01B 39/00 - Composés ayant des propriétés de tamis moléculaires et d'échangeurs de base, p. ex. zéolites cristallinesLeur préparationPost-traitement, p. ex. échange d'ions ou extraction de l'aluminium
• C01B 39/02 - Zéolites aluminosilicates cristallinesLeurs composés isomorphesLeur préparation directeLeur préparation à partir d'un mélange réactionnel contenant une zéolite cristalline d'un autre type, ou à partir de réactants préformésLeur post-traitement

Abrégé

Measurement of both quantitative absolute concentrations and frequency-dependent cross-sectional areas of atoms and molecules by absorption, transmission, and reflection spectroscopy techniques, are of great importance for many fields, especially analytical and physical chemistry. Optical spectrometers are widely used initially in optical identification of materials, chemical analysis, security applications, astronomical discoveries, and biomedical diagnostics. The use of optical spectrometers is increasing with our scientific and technological advancement, and the need for portable optical spectrometers with higher performance, low weight, and small volume are important. Also, high accuracy spectrometers are needed for a trace amount of sample/analyte detection. This invention relates to a high-resolution optical spectrometer with multiple diffractive optical elements that can operate under broadband light. Unlike commonly used diffraction gratings, our invention enables spectral splitting with 3D diffractive optical elements. The diffractive optical elements used provide concentration of light as well as spectral splitting. Depending on the application, the system can work with a reflection or transmission diffractive optical element. Our invention makes it possible to vary the number of operating wavelengths, spectral resolution, and operating bandwidth of diffractive optical elements depending on application.

Classes IPC  ?

• G01J 3/12 - Production du spectreMonochromateurs
• G01J 3/18 - Production du spectreMonochromateurs en utilisant des éléments diffractants, p. ex. réseaux

Abrégé

A method does not use high resource and high power consuming memory elements (LUT, Block RAM, etc.) or a distributed RAM in an implementation of nonlinear activation functions of artificial neural networks (ANN), eliminating a need for multiplication elements completely by using shift operations. Since each neuron includes an activation function, eliminating a multiplication element saves significant amount of resource and power in an implementation of the ANN.

Classes IPC  ?

• G06N 3/04 - Architecture, p. ex. topologie d'interconnexion
• G06N 3/08 - Méthodes d'apprentissage
• G06F 5/01 - Procédés ou dispositions pour la conversion de données, sans modification de l'ordre ou du contenu des données maniées pour le décalage, p. ex. la justification, le changement d'échelle, la normalisation

Abrégé

The present invention is an encapsulation method for transporting the genetic molecule in a preservative material, most generally, comprises the following process steps of adding alcohol to a silica source and polyethylene glycol source and mixing and obtaining two separate solutions, adding the polyethylene glycol solution to the silica solution, mixing and adding water to hydrolyze the solution, during condensation, just before gelling, in order to transport inside the pores of the amorphous structure formed, adding a genetic molecule in its buffer solution to the hydrolyzed solution or adding the hydrolyzed solution to a genetic molecule in its buffer solution and then obtaining a gel, obtaining a dry gel by drying/aging the gel and powdering the dry gel. Hybrid material of the mesoporous silica/polyethylene glycol and silica/polyethylene glycol/polyethyleneimine, carrying the genetic molecule inside, obtained by this method, is also covered by the scope of invention.

Classes IPC  ?

• A61K 48/00 - Préparations médicinales contenant du matériel génétique qui est introduit dans des cellules du corps vivant pour traiter des maladies génétiquesThérapie génique
• C12N 15/11 - Fragments d'ADN ou d'ARNLeurs formes modifiées
• C12N 15/88 - Introduction de matériel génétique étranger utilisant des procédés non prévus ailleurs, p. ex. co-transformation utilisant la micro-encapsulation, p. ex. utilisant des vésicules liposomiques
• C01B 33/18 - Préparation de silice finement divisée ni sous forme de sol ni sous forme de gelPost-traitement de cette silice

Abrégé

The invention relates to a multi-purpose barrier-free access system which can easily be adjusted to different levels of heights in both indoors and outdoors with air, marine, land and railway transportation vehicles, and which can be used by all individuals, with or without disabilities.

Classes IPC  ?

• A61G 3/06 - Transfert en utilisant des rampes, des ascenseurs ou analogues
• B66F 7/00 - Châssis de levage, p. ex. pour lever des véhiculesAscenseurs à tablier

Abrégé

A method for reducing a total operational load of a method of a model predictive control-by conducting simplifications based on specific observations, in order to drive alternating current motors by using the method of the MPC with a two-level voltage source inverter. The method includes the steps of determining at which one of the predefined sectors a resultant of stator currents is present, determining a motor mode, reducing seven estimation vectors to four estimation vectors and calculating a cost function or reducing seven estimation vectors to five estimation vectors and calculating the cost function.

Classes IPC  ?

• H02P 21/00 - Dispositions ou procédés pour la commande de machines électriques par commande par vecteur, p. ex. par commande de l’orientation du champ
• H02P 21/14 - Estimation ou adaptation des paramètres des machines, p. ex. flux, courant ou tension
• H02P 27/06 - Dispositions ou procédés pour la commande de moteurs à courant alternatif caractérisés par le type de tension d'alimentation utilisant une tension d’alimentation à fréquence variable, p. ex. tension d’alimentation d’onduleurs ou de convertisseurs utilisant des convertisseurs de courant continu en courant alternatif ou des onduleurs

Abrégé

Pichia pastoris ADH2 promoter (SEQ ID NO: 1). The modification includes one of the following mutations: integration of a Cat8 transcription factor binding site (TFBS), particularly integration of SEQ ID NO: 3 or other gene sequences that show at least 80% similarity with this sequence, at any positions within nucleotides a) 647 to 660; b) 739 to 752; c) 1 to 948; and d) mutations specified with SEQ ID NO: 2 within nucleotides 15 to 848 separately and combinations thereof.

Classes IPC  ?

• C12N 15/10 - Procédés pour l'isolement, la préparation ou la purification d'ADN ou d'ARN
• C07K 14/39 - Peptides ayant plus de 20 amino-acidesGastrinesSomatostatinesMélanotropinesLeurs dérivés provenant de champignons provenant de levures
• C12N 1/14 - ChampignonsLeurs milieux de culture
• C12N 15/81 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes eucaryotes pour champignons pour levures
• C12R 1/72 - Candida
• C12R 1/78 - Hansenula
• C12R 1/84 - Pichia
• C12R 1/88 - Torulopsis

Abrégé

A system to develop a light detection and range determination (LIDAR) application by a rotation of optical elements embedded on a rotating disk in a spherical geometry is provided. The system further enables to conduct a fastest possible spatial scanning mechanically and to determine flight times of light beams by adaptive elements according to a distance and a size of a target region.

Classes IPC  ?

• G01S 7/481 - Caractéristiques de structure, p. ex. agencements d'éléments optiques
• G02B 26/12 - Systèmes de balayage utilisant des miroirs à facettes multiples
• G02B 26/10 - Systèmes de balayage
• G01S 17/89 - Systèmes lidar, spécialement adaptés pour des applications spécifiques pour la cartographie ou l'imagerie

Abrégé

A self-operating oscillator which increases an input DC voltage by a coefficient factor of 4 or more is provided. The self-operating oscillator includes a primary LC tank pair, a secondary LC tank pair, and a switch pair. The primary and the secondary LC tank provide a differential sinusoidal output voltage which corresponds to high amplitude, low phase noise and high purity.

Classes IPC  ?

• H03B 5/12 - Éléments déterminant la fréquence comportant des inductances ou des capacités localisées l'élément actif de l'amplificateur étant un dispositif à semi-conducteurs

Abrégé

Near-infrared (NIR) absorbing photosensitizers for imaging and treatment of cancer in a photodynamic therapy (PDT) are provided. Specifically, the NIR photosensitizers are mitochondria targeted and water-soluble, and used as a cytotoxic drug in a photodynamic therapy of the cancer. The NIR photosensitizers are activated with wavelengths of light, wherein the light penetrates through a body not just a skin. Hence the NIR photosensitizers aim to transform PDT from being a specialized treatment to a generally applicable one. PDT is almost completely non-invasive compared to current treatment methods.

Classes IPC  ?

• A61K 41/00 - Préparations médicinales obtenues par traitement de substances par énergie ondulatoire ou par rayonnement corpusculaire
• C07F 5/02 - Composés du bore
• C07F 7/08 - Composés comportant une ou plusieurs liaisons C—Si

Abrégé

The invention is related to a Low-Stress Stereolithography comprising a mobile tank that has a tilted structure that can carry out mobile laser and oscillation motion.

Classes IPC  ?

• B29C 64/10 - Procédés de fabrication additive

Abrégé

The invention is related to the field and methodologies of "nonlinear system identification in structural dynamics". In other words, it is related to the field and methodologies of constructing a mathematical model describing the vibration behaviour of a nonlinear system using experimental data. Moreover, the invention can also be used for systems in which nonlinear properties can be neglected.

Classes IPC  ?

• G01H 1/00 - Mesure des vibrations dans des solides en utilisant la conduction directe au détecteur
• G01M 7/02 - Test de vibration

Abrégé

In the present invention, an analog distortion generator generating a distortion signal to prevent intermodulation distortion that occurs when amplifying multitone signals is developed. The said analog distortion generator comprises at least one signal generator (O) generating at least one mixing signal (Vm); at least one first mixer (1) for mixing a multitone input signal (Vin) with the said mixing signal (Vm) to form an intermediate frequency signal (Vif); at least one second mixer (2) that enables the formation of an output signal (Vo) by mixing the intermediate frequency signal (Vif) generated by the first mixer (1) with said mixing signal (Vm).

Classes IPC  ?

• H03F 1/32 - Modifications des amplificateurs pour réduire la distorsion non linéaire
• H03F 3/24 - Amplificateurs de puissance, p. ex. amplificateurs de classe B, amplificateur de classe C d'étages transmetteurs de sortie

Abrégé

A method is provided for acoustic source direction of arrival estimation and acoustic source separation, via spatial weighting of the dictionary based display of the steered response function calculated for a certain number of directions from spherical harmonic decomposition coefficients obtained from microphone array recordings of the sound field. The usage of spatial band limited functions of plane waves to represent more complex directional maps of the sound field constitutes the algorithm. These functions are calculated for pre-defined directions on an analysis surface (such as a sphere). The directions of arrival of sound sources are calculated with the same method in order to group source estimates to localize sound sources. Thereby, directions of arrival can be obtained from the recordings of the sound sources captured by means of a microphone array and following this, sound sources can be separated by using this direction information or predetermined source arrival directions.

Classes IPC  ?

• G10L 21/028 - Séparation du signal de voix utilisant les propriétés des sources sonores
• G10L 21/0272 - Séparation du signal de voix
• G10L 21/0216 - Filtration du bruit caractérisée par le procédé d’estimation du bruit

Abrégé

Chemiluminescence, or chemical luminescence, is the condition of a very small amount of thermal radiation and light radiation as a consequence of the chemical reaction that takes place in the substance. The luminol compound known in the literature is a chemiluminescent substance and is usually used in various applications. Luminol is an acyl-hydrazide ring and it contains the typical properties of this class. Its properties such as photo and thermal stability and chemical behavior in protic polar environments make this substance a good candidate in forensic science. When some important disadvantages of luminol (insolubility, low luminous quantum efficiency (1%) and misleading results in tests and/or disrupting the biologically active (DNA, etc.) structure in the sample being studied, etc.) are taken into consideration, new compounds that are designed so as to eliminate these disadvantages have great importance. It is required to use equally effective markers so as to make effective imaging, especially at the scene of a crime in forensic science. It is considered that this problem will be eliminated by means of these compounds. If the compounds designed in the same manner (different from luminol) only respond to iron ions, the fact about the images taken at the scene of a crime is based on blood samples will be obtained in a more evidential manner/with more clear evidence. After this study, the chemiluminescent radiation sensitivity of the compounds (especially for the detection of blood findings on the scene in forensic cases) to hemin and blood samples will be analyzed.

Classes IPC  ?

• G01N 21/76 - ChimioluminescenceBioluminescence
• G01N 33/50 - Analyse chimique de matériau biologique, p. ex. de sang ou d'urineTest par des méthodes faisant intervenir la formation de liaisons biospécifiques par ligandsTest immunologique

Abrégé

The invention in general is related to a magnetic modular fixture (fixation) system and a method thereof which enables processing/ manufacturing mechanical work pieces which comprises precise geometrical elements with a high accuracy. Said magnetic modular fixture (fixation) system and a method thereof enables processing/ manufacturing said parts by means of preventing thermal and mechanical stress on the work pieces with precise geometry.

Classes IPC  ?

• B23Q 1/03 - Supports fixes d'outils ou de pièces
• B23Q 1/25 - Supports mobiles ou réglables d'outils ou de pièces
• B23Q 3/06 - Moyens de fixation de la pièce
• B23K 37/04 - Dispositifs ou procédés auxiliaires non spécialement adaptés à un procédé couvert par un seul des autres groupes principaux de la présente sous-classe pour maintenir ou mettre en position les pièces
• B25B 11/00 - Porte-pièces ou dispositifs de mise en position non couverts par l'un des groupes , p. ex. porte-pièces magnétiques, porte-pièces utilisant le vide
• B23Q 37/00 - Machines ou combinaisons de machines pour le travail des métaux réalisées à partir d'unités conçues de telle façon que quelques-unes au moins de ces unités soient en mesure de tenir lieu d'éléments de différentes machines ou combinaisonsCes unités tant que la caractéristique d'interchangeabilité en est importante
• F16M 13/00 - Autres supports ou appuis pour positionner les appareils ou les objetsMoyens pour maintenir en position les appareils ou objets tenus à la main

Abrégé

The invention, is related to environmentally friendly materials that have been formed by increasing the antimicrobial effectiveness, antimicrobial efficiency and thermal resistance thereof, by encapsulating thymol and other similar organic molecules that are antimicrobial essential oils, that are not limited with a pore size, and that have been given a hierarchical structure by expanding their microporosities, into zeotype materials having a silicate structure with a low Si/Al ratio varying between 1-3 or titanium chain.

Classes IPC  ?

• A01N 25/08 - Biocides, produits repoussant ou attirant les animaux nuisibles, ou régulateurs de croissance des végétaux, caractérisés par leurs formes, ingrédients inactifs ou modes d'applicationSubstances réduisant les effets nocifs des ingrédients actifs vis-à-vis d'organismes autres que les animaux nuisibles contenant des solides comme supports ou diluants
• A61L 2/235 - Procédés ou appareils de désinfection ou de stérilisation de matériaux ou d'objets autres que les denrées alimentaires ou les lentilles de contactAccessoires à cet effet utilisant des substances chimiques des substances solides, p. ex. des granules, des poudres, des blocs, des comprimés cellulaires, poreuses ou sous forme de mousses

Abrégé

The invention relates to MEMS airborne ultrasonic transducer system to determine brain haemorrhage based on detecting RF-induced, blood-originating, thermoacoustic ultrasound wave at the pulse modulation frequency.

Classes IPC  ?

• A61B 5/05 - Détection, mesure ou enregistrement pour établir un diagnostic au moyen de courants électriques ou de champs magnétiquesMesure utilisant des micro-ondes ou des ondes radio
• A61B 8/06 - Mesure du débit sanguin
• G01N 33/48 - Matériau biologique, p. ex. sang, urineHémocytomètres

Abrégé

The present invention relates to machine windings that are important components of electrical machines. The invention characterized in that it is cut from a thin electrically conductive sheet (1) and has at least one bending point such as the lower bending point (5), the middle bending point (6) and the upper bending point (7), and that the bending angles are at least 90° and not more than 180°. Another characterization of the invention is that more than one electrical machine windings (9) are connected with the end winding connectors (17) from the end windings (13), and an electrical insulating material (16) is placed between two adjacent electrical machine windings (9) to provide electrical insulation therebetween, thus obtaining the multiple electrical machine winding (14). While this winding method of the invention provides ease of production for electrical machine windings, it can also increase the efficiency with short end winding (13) and satisfy high current requirements.

Classes IPC  ?

• H02K 15/04 - Procédés ou appareils spécialement adaptés à la fabrication, l'assemblage, l'entretien ou la réparation des machines dynamo-électriques d'enroulements avant leur montage dans les machines
• H02K 3/00 - Détails des enroulements
• H01B 5/00 - Conducteurs ou corps conducteurs non isolés caractérisés par la forme

Abrégé

The invention is related to a novel modal superposition method using the response dependent non-linear mode concept for vibration analysis of non-linear engineering structures.

Classes IPC  ?

• G06F 17/10 - Opérations mathématiques complexes

Abrégé

A spherically steerable microphone array structure is disclosed which uses pressure and acoustic particle velocity signals obtained from sensors that are positioned co-planarly on a circular arc. The invention allows the calculation of all spatial partial derivatives of the sound field up to a given order. These spatial derivatives are used to obtain a spherical harmonic decomposition of the recorded sound field. The spherical harmonic decomposition coefficients are used in spherically direction-invariant acoustic mode beamforming.

Classes IPC  ?

• H04R 3/00 - Circuits pour transducteurs
• H04R 1/40 - Dispositions pour obtenir la fréquence désirée ou les caractéristiques directionnelles pour obtenir la caractéristique directionnelle désirée uniquement en combinant plusieurs transducteurs identiques

Abrégé

The neutron detector that allows the measurement of neutrons under different energies enable the solid and liquid moderators with changeable thicknesses to be used in the same design. The detector is simply comprised of a cylindrical solid moderator movement chamber (1), a detector measurement chamber (2) and a liquid moderator storage chamber (3), which are stacked on each other. The detector measurement chamber (2) is formed of a detector (4) at the center and a tungsten sheath (9) providing a shield to the detector by surrounding it, against gamma radiation. The solid moderator motion lever (5) is fixed to the solid moderators (7) and hence enables them to move in the vertical axis.

Classes IPC  ?

• G01T 5/00 - Enregistrement des mouvements ou des tracés de particulesTraitement ou analyse de ces tracés
• G01T 3/02 - Mesure de flux de neutrons en faisant écran aux autres radiations
• G01T 3/00 - Mesure de flux de neutrons

Abrégé

222 nanodispersive solution from dolomite itself and the method of its application to strengthen the deteriorated dolomite stone (dolostone) by synthesizing dolomite within the weak parts of the stone.

Classes IPC  ?

• C04B 2/00 - Chaux, magnésie ou dolomite

Abrégé

The invention is related to the recycling method of polylactic acid in a single step by using supercritical or dense gas carbon dioxide.

Classes IPC  ?

• C08J 11/00 - Récupération ou traitement des résidus
• C08J 11/04 - Récupération ou traitement des résidus des polymères
• C08J 11/16 - Récupération ou traitement des résidus des polymères par coupure des chaînes moléculaires des polymères ou rupture des liaisons de réticulation par voie chimique, p. ex. dévulcanisation par traitement avec une substance inorganique
• B29B 17/00 - Récupération de matières plastiques ou d'autres constituants des déchets contenant des matières plastiques

Abrégé

The invention relates to fiber optic MEMS microphone that features electrically deflectable MEMS membrane via conversion of optical energy propagating in the optical fiber to electrical energy with photodiode chip.

Classes IPC  ?

• G01H 9/00 - Mesure des vibrations mécaniques ou des ondes ultrasonores, sonores ou infrasonores en utilisant des moyens sensibles aux radiations, p. ex. des moyens optiques
• H04R 23/00 - Transducteurs autres que ceux compris dans les groupes

Abrégé

The present invention generally relates to detection of concealed objects under the clothes of humans using passive MMW/THz imaging technique with variable focal length configuration.

Classes IPC  ?

• G01S 13/88 - Radar ou systèmes analogues, spécialement adaptés pour des applications spécifiques
• G01V 8/00 - Prospection ou détection par des moyens optiques

Abrégé

A method for learning deep convolutional features specifically designed for correlation filter based visual tracking includes the steps of, selecting a first image from a first image patch; selecting a second image from a second image patch; forward propagating selected first image by a convolutional neural network model formula, the formula has random weights with zero mean for the parameters; forward propagating selected second image by the convolutional neural network model formula; computing correlation filter using forward propagated second image and centered correlation response; circularly correlating forward propagated first image and computed correlation filter to generate predicted response map; calculating the loss by comparing the predicted response map with desired correlation corresponding selected first image and second image and updating the parameters of the convolutional neural network model formula according to calculated loss.

Classes IPC  ?

• G06K 9/62 - Méthodes ou dispositions pour la reconnaissance utilisant des moyens électroniques
• G06K 9/20 - Obtention de l'image
• G06N 3/08 - Méthodes d'apprentissage

Abrégé

The invention is related to a system which enables to develop a LIDAR application by means of the rotation of optical elements that have been embedded on a rotating disk in a spherical geometry, which also enables to conduct the fastest possible spatial scanning mechanically and to determine the flight times of these light beams by means of adaptive elements according to the distance and size of the target region.

Classes IPC  ?

• G01S 17/88 - Systèmes lidar, spécialement adaptés pour des applications spécifiques
• G01S 7/481 - Caractéristiques de structure, p. ex. agencements d'éléments optiques
• G01S 17/00 - Systèmes utilisant la réflexion ou la reradiation d'ondes électromagnétiques autres que les ondes radio, p. ex. systèmes lidar

Abrégé

The present invention relates to a semiconductor photodiode (photodetector) which functions in a wide band range up to medium wave infrared and far wavelengths in addition to visible region and near infrared and comprises the doped state of black silicon with elements of chalcogen group (S(sulfur), Se(selenium) and Te(tellurium)); and obtaining method thereof.

Classes IPC  ?

• H01L 21/02 - Fabrication ou traitement des dispositifs à semi-conducteurs ou de leurs parties constitutives
• H01L 31/02 - Dispositifs à semi-conducteurs sensibles aux rayons infrarouges, à la lumière, au rayonnement électromagnétique d'ondes plus courtes, ou au rayonnement corpusculaire, et spécialement adaptés, soit comme convertisseurs de l'énergie dudit rayonnement e; Procédés ou appareils spécialement adaptés à la fabrication ou au traitement de ces dispositifs ou de leurs parties constitutives; Leurs détails - Détails

Abrégé

The invention subject to the application is related to a method of establishing support structures used in additive manufacturing methods based on the material layering with extrusion principle with 3D printers, wherein the method is characterized in that additive manufacturing carried out by material layering with extrusion is performed in a recyclable particle tank (powder, sand, particle etc.).

Classes IPC  ?

• B29C 64/118 - Procédés de fabrication additive n’utilisant que des matériaux liquides ou visqueux, p. ex. dépôt d’un cordon continu de matériau visqueux utilisant un matériau filamentaire mis en fusion, p. ex. modélisation par dépôt de fil en fusion [FDM]
• B29C 64/357 - Recyclage

Abrégé

The invention relates to a novel method for reducing the total operational load of the method of model predictive control (MPC) by conducting simplifications based on specific observations, in order to drive alternating current (AC) motors by using the method of MPC with a two-level voltage source inverter (2L-VSI).

Classes IPC  ?

• H02M 1/12 - Dispositions de réduction des harmoniques d'une entrée ou d'une sortie en courant alternatif

Abrégé

Pichia pastoris alcohol oxidase 1 (AOX1) promoter variants are characterized by comprising at least one of the specified modifications on wild-type Pichia pastoris AOX1 promoter given by SEQUENCE No 1; said promoter variants include a mutation selecting from the group consisting of: a) integration of a Cat8 transcription factor binding site (TFBS), particularly integration of the ''TTCCGTTCGTCCGA'' gene sequence or other gene sequences that show at least 80% similarity with this sequence, at any positon within nucleotides 94 to 110 (-847 to -831), 141 to 160 (-800 to -781), 312 to 330 (-629 to -611), 355 to 380 (-586 to -561), 501 to 521 (-440 to -420); 640 to 658 (-301 to -283), 674 to 693 (-267 to -248), and 1 to 840 (-940 to -100); b) integration of Aca1 or Aca2 TFBS particularly integration of the "GCCTATTGTAGACGTCAACCC" nucleotide sequence or other gene sequences showing at least 80% similarity with this sequence at any position between the nucleotides 1 to 840 (-940 to -100); c) mutations specified with SEQUENCE No. 2 within nucleotides 94 to 693 (-847 to -248) and combinations thereof; and AOX1 promoter variants further characterized by their enhanced strenght and induction potential when compared with the wild-type AOX1 promoter.

Classes IPC  ?

• C12N 15/09 - Technologie d'ADN recombinant
• C12N 15/79 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes eucaryotes

Abrégé

Pichia pastorisPichia pastoris Pichia pastoris ADH2 promoter given by SEQUENCE No 1; said promoter variants include a mutation selecting from the group consisting of integration of a Cat8 transcription factor binding site (TFBS), particularly integration of the ''TTCCGTTCGTCCGA'' gene sequence or other gene sequences that show at least 80% similarity with this sequence, at any positon within nucleotides a) 647 to 660 (-401 to -388); b) 739 to 752 (-309 to -296); c) 1 to 948 (-1047 to -100); and d) mutations specified with SEQUENCE No. 2 within nucleotides 15 to 848 (-1033 to -200) seperately and combinations thereof; and ADH2 promoter variants further characterized by their enhanced strenght and induction potential when compared with the wild-type ADH2 promoter.

Classes IPC  ?

• C12N 15/09 - Technologie d'ADN recombinant
• C12N 15/79 - Vecteurs ou systèmes d'expression spécialement adaptés aux hôtes eucaryotes

Abrégé

This invention is related to a method of producing nano and micro sized particles having anisotropic composition and/or morphology. This composition distribution can be on the surface (core-shell) or throughout the particle (coreless). The particles that are produced can be metal, inorganic, or combinations thereof; and these types of particles are known as hard anisotropic particles.

Classes IPC  ?

• B22F 1/00 - Poudres métalliquesTraitement des poudres métalliques, p. ex. en vue de faciliter leur mise en œuvre ou d'améliorer leurs propriétés
• C22C 12/00 - Alliages à base d'antimoine ou de bismuth
• C22C 13/00 - Alliages à base d'étain

Abrégé

The invention is related to a method that enables acoustic source direction of arrival estimation and acoustic source separation, via spatial weighting of the dictionary based display of the steered response function calculated for a certain number of directions from spherical harmonic decomposition coefficients obtained from microphone array recordings of the sound field. The usage of spatial band limited functions of plane waves to represent more complex directional maps of the sound field constitutes the algorithm of the invention. These functions are calculated for pre-defined directions on an analysis surface (such as a sphere). The directions of arrival of sound sources are calculated with the same method in order to group source estimates to localize sound sources. Thereby, directions of arrival can be obtained from the recordings of the sound sources captured by means of a microphone array and following this, sound sources can be separated by using this direction information or predetermined source arrival directions.

Classes IPC  ?

• G01S 3/00 - Radiogoniomètres pour déterminer la direction d'où proviennent des ondes infrasonores, sonores, ultrasonores ou électromagnétiques ou des émissions de particules sans caractéristiques de direction

Abrégé

The present invention is related to a self operating oscillator which increases an input DC voltage with a coefficient factor of 4 or more, by using a primary and a secondary LC tank in order to provide a differential sinusoidal output voltage which corresponds to high amplitude, low phase noise and high purity.

Classes IPC  ?

• H03L 7/099 - Détails de la boucle verrouillée en phase concernant principalement l'oscillateur commandé de la boucle
• H03B 5/12 - Éléments déterminant la fréquence comportant des inductances ou des capacités localisées l'élément actif de l'amplificateur étant un dispositif à semi-conducteurs

Abrégé

The present invention relates to photosensitizers to be used for imaging and treatment of cancer in photodynamic therapy.

Classes IPC  ?

• C07F 5/02 - Composés du bore
• C08K 5/55 - Composés contenant du bore
• C09K 11/06 - Substances luminescentes, p. ex. électroluminescentes, chimiluminescentes contenant des substances organiques luminescentes
• G01N 21/64 - FluorescencePhosphorescence
• G01N 21/75 - Systèmes dans lesquels le matériau est soumis à une réaction chimique, le progrès ou le résultat de la réaction étant analysé

Abrégé

The present invention relates to a portable air conditioner is used to condition indoors and which can be integrated onto a door leaf basically comprising; an inner unit including a housing in the shape of a recess with a suitable size to allow the inner unit to fit into the door leaf, and an opening that is integrated to the door leaf and is used in the area to be conditioned, an outer unit that is used such as to be outside the area to be conditioned, a body that extends between bottom portions of the inner unit and the outer unit and includes a connection path connecting the inner unit and the outer unit to each other, and at least two wheels that are located at the bottom of the body which are used to move the body.

Classes IPC  ?

• F24F 1/00 - Climatiseurs individuels pour le conditionnement de l'air, p. ex. éléments séparés ou monoblocs ou éléments recevant l'air primaire d'une station centrale
• F24F 1/02 - Climatiseurs individuels monoblocs pour le conditionnement de l'air, c.-à-d. avec tout l'appareillage nécessaire au traitement placé dans une enveloppe
• F24F 5/00 - Systèmes ou appareils de conditionnement d'air non couverts par ou
• F24F 11/50 - Aménagements de commande ou de sécurité caractérisés par des interfaces utilisateurs ou par la communication

Abrégé

The invention is related to a "nondiscriminatory access system for public/collective living spaces" which eases the access problems for the disabled without asking for assistance in said public/collective living spaces, where the boarding platform is higher or lower than the ground level.

Classes IPC  ?

• B65G 69/00 - Mesures auxiliaires ou dispositifs utilisés en liaison avec le chargement ou le déchargement

Abrégé

With the present application, a method for learning deep convolutional features specifically designed for correlation filter based visual tracking is provided. Said method comprises the steps of, selecting a first image (xi) from a first image patch; selecting a second image (yi) from a second image patch; forward propagating selected first image (xi) (101 ) by a convolutional neural network model formula (ƒθ(. )), wherein said formula has random weights with zero mean for the parameters (θ); forward propagating selected second image (yi) (102) by said convolutional neural network model formula ((ƒθ(. )); computing correlation filter using forward propagated second image (yi) and centered correlation response (ci) (103); circularly correlating forward propagated first image (xi) and computed correlation filter (104) to generate predicted response map (105); calculating the loss (106) by comparing the predicted response map (105) with desired correlation (gi) corresponding selected first image (xi) and second image (yi) and updating the parameters (θ) of said convolutional neural network model formula ((ƒθ(. )) according to calculated loss (107).

Classes IPC  ?

• G06T 7/246 - Analyse du mouvement utilisant des procédés basés sur les caractéristiques, p. ex. le suivi des coins ou des segments